Climatic evolution of eastern South America during the last deglaciation: a paleoceanographic approach

Para dar suporte ao atual debate sobre as consequências climáticas da liberação antropogênica de CO2 na atmosfera, o refinamento do conhecimento sobre mudanças climáticas e oceanográficas no passado é necessário. A Circulação de Revolvimento Meridional do Atlântico (CRMA) tem papel fundamental na oceanografia e clima das áreas sob influência do Oceano Atlântico, controlando diretamente a estratificação e distribuição de massas d\'água, a quantidade de calor transportada pelo oceano e os ciclo e armazenamento de compostos químicos, como o CO2 em mar profundo. A formação e circulação da Água Intermediária Antártica (AIA), envolvida no transporte de calor e sal para o giro subtropical do Hemisfério Sul e nas teleconexões climáticas entre altas e baixas latitudes, é componente importante do ramo superior da CRMA. A reconstrução de propriedades de massas de água intermediárias é, portanto, importante para a compreensão dos sistemas de retroalimentação entre oceano-clima. No entanto, informações quanto a evolução da AIA continuam limitadas. Oscilações da CRMA e consequentes mudanças na distribuição de calor tem implicações importantes para o clima Sul Americano, influenciando a disponibilidade de umidade para o Sistema de Monções Sul Americano (SMSA), via temperatura da superfície marinha e posicionamento da Zona de Convergência Intertropical. Neste trabalho nós reconstruímos a assinatura isotópica da AIA durante os estágios isotópicos marinhos 2 e 3 (41-12 cal ka AP) usando isótopos de carbono e oxigênio de foraminíferos bentônicos (gêneros Cibicidoides e Uvigerina) de um testemunho de sedimentos marinhos datados por radiocarbono (1100 m de profundidade e a 20°S na costa do Brasil). Concluímos que propriedades físicas e químicas da AIA mudaram durante os estadiais Heinrich 3 e 4, provavelmente como consequência de enfraquecimento da CRMA durante estes períodos. Também reconstruímos as condições continentais do leste brasileiro entre o último máximo glacial e a deglaciação (23-12 cal ka AP) baseadas em razões Ti/Ca de nosso testemunho de sedimentos marinhos como indicadoras de aporte terrígeno do Rio Doce. A maior parte da chuva que cai na Bacia do Rio Doce está relacionada a atividade do SMAS. Nosso registro de Ti/Ca em conjunto com \'\'delta\' POT.18\'O de espeleotemas da Caverna Lapa Sem Fim, também no leste do Brasil, sugere diminuição marcante da chuva durante o interestadial Bølling-Allerød, provavelmente relacionada a enfraquecimento do SMAS. Ademais comparamos as razões de Ti/Ca com dados de saída da rodada SYNTRACE do modelo climático CCSM3 com forçantes transientes para a última deglaciação. Os registros geoquímicos e a saída do modelo mostram resultados consistentes entre si e sugerem que o leste da América do Sul passou pelo seu período mais seco de toda a última deglaciação durante o interestadial Bølling-Allerød, provavelmente relacionado ao enfraquecimento do SMAS.

Memoir on the navigation of South America, to accompany a chart of that station.

pt. 1. List of the passages made in H.M.S. Conway, on the South American station, by Captain Basil Hall.--pt. 2. Remarks on the sailing round Cape Horn [April 1814 and March 1815 by] Captain Pipon, on H.M.S. Tagus.

Military spending and economic growth in South Africa

This paper undertakes an empirical analysis of the economic effects of military spending on the South African economy. It estimates a neo-classical model common in the literature at the level of the macroeconomy and at the level of the manufacturing sector. An attempt is made to improve upon the model by allowing the data to determine the dynamic structure of the model through an ARDL procedure. No significant impact of military spending is found in aggregate, but there is a significant negative impact for the manufacturing sector. This suggests that the cuts in domestic military procurement that have occurred since 1989 could lead to improved economic performance in South Africa through their impact on the manufacturing sector.

Mexico 1968 and South Africa 2010: development, leadership and legacies

In this essay we compare the rationales for hosting the 1968 Olympic Games in Mexico City with the FIFA World Cup 2010 to be held in South Africa. We draw on in-depth interviews, archival materials and a range of press coverage. We argue that three broad overlapping themes are apparent in both case studies. These are the developmental rhetoric both hosts employ in the justification of holding the events in their respective countries. Mexico and South Africa convey a leadership role that stretches across the South American and African continent respectively. Finally, both countries argue that the legacy the respective tournament leaves is important.

Altered Landscape or Arms Race? Making Sense of Military Spending in South America

In 2009, South American military spending reached a total of $51.8 billion, a fifty percent increased from 2000 expenditures. The five-year moving average of arms transfers to South America was 150 percent higher from 2005 to 2009 than figures for 2000 to 2004.[1] These figures and others have led some observers to conclude that Latin America is engaged in an arms race. Other reasons, however, account for Latin America’s large military expenditure. Among them: Several countries have undertaken long-prolonged modernization efforts, recently made possible by six years of consistent regional growth.[2] A generational shift is at hand. Armed Forces are beginning to shed the stigma and association with past dictatorial regimes.[3] Countries are pursuing specific individual strategies, rather than reacting to purchases made by neighbors. For example, Brazil wants to attain greater control of its Amazon rainforests and offshore territories, Colombia’s spending demonstrates a response to internal threats, and Chile is continuing a modernization process begun in the 1990s.[4] Concerns remain, however: Venezuela continues to demonstrate poor democratic governance and a lack of transparency; neighbor-state relations between Colombia and Venezuela, Peru and Chile, and Bolivia and Paraguay, must all continue to be monitored; and Brazil’s military purchases, although legitimate, will likely result in a large accumulation of equipment.[5] These concerns can be best addressed by strengthening and garnering greater participation in transparent procurement mechanism.[6] The United States can do its part by supporting Latin American efforts to embrace the transparency process. _________________ [1] Bromley, Mark, “An Arms Race in Our Hemisphere? Discussing the Trends and Implications of Military Expenditures in South America,” Brookings Institution Conference, Washington, D.C., June 3rd, 2010, Transcript Pgs. 12,13, and 16 [2] Robledo, Marcos, “The Rearmament Debate: A Chilean Perspective,” Power Point presentation, slide 18, 2010 Western Hemisphere Security Colloquium, Miami, Florida, May 25th-26th, 2010 [3] Yopo, Boris, “¿Carrera Armamentista en la Regiόn?” La Tercera, November 2nd, 2009, http://www.latercera.com/contenido/895_197084_9.shtml, accessed October 8th, 2010 [4] Walser, Ray, “An Arms Race in Our Hemisphere? Discussing the Trends and Implications of Military Expenditures in South America,” Brookings Institution Conference, Washington, D.C., June 3rd, 2010, Transcript Pgs. 49,50,53 and 54 [5] Ibid., Guevara, Iñigo, Pg. 22 [6] Ibid., Bromley, Mark, Pgs. 18 and 19

Post-liberal Regionalism in South America: The Case of UNASUR

This paper examines the formal features, the political rationale, distinctiveness, potential, and difficulties of post-liberal regionalism, with a particular focus on the case of UNASUR. Through this organization, traditional unionism and aspirations of Latin American regional integration are redefined in a South American geographic and ideational framework. Through this strategy South America became a political and economic construct in order to respond to globalization challenges and to achieve its members’ goals in development, regional autonomy (particularly in regards to the US), international influence and at the same time domestic governance of the involved countries. Nevertheless, the limits of this project’s future are being defined by nationalism, traditional visions of sovereignty and by a regional construction that involve significant institutional limitations, which are product of its intergovernmental logic, internal asymmetries and ambivalent Brazilian leadership

Mid-Holocene multiproxy compilation for eastern South America

The mid-Holocene (6000 calibrated years before present) is a key period in palaeoclimatology because incoming summer insolation was lower than during the late Holocene in the Southern Hemisphere, whereas the opposite happened in the Northern Hemisphere. However, the effects of the decreased austral summer insolation over South American climate have been poorly discussed by palaeodata syntheses. In addition, only a few of the regional studies have characterised the mid-Holocene climate in South America through a multiproxy approach. Here, we present a multiproxy compilation of mid-Holocene palaeoclimate data for eastern South America. We compiled 120 palaeoclimatological datasets, which were published in 84 different papers. The palaeodata analysed here suggest a water deficit scenario in the majority of eastern South America during the mid-Holocene if compared to the late Holocene, with the exception of northeastern Brazil. Low mid-Holocene austral summer insolation caused a reduced land-sea temperature contrast and hence a weakened South American monsoon system circulation. This scenario is represented by a decrease in precipitation over the South Atlantic Convergence Zone area, saltier conditions along the South American continental margin, and lower lake levels.

‘Every Coward’s Choice’? Political Objection to Military Service in Apartheid South Africa as Sexual Citizenship

Sexuality was articulated by the apartheid state as a means of disciplining the white population and marginalizing white opponents of apartheid. As such, homophobia was a recurrent feature of political and legal discourse. The End Conscription Campaign (ECC) opposed compulsory conscription for all white men in the apartheid era South African Defence Force (SADF). Its challenge was a potentially radical and profoundly destabilizing one and it articulated a competing definition of citizenship to that offered by the state. The pro‐ and anti‐conscription discourse was inherently gendered and overtly sexualized. The South African government regularly associated men who objected to military service with effeminacy, cowardice and sexual ‘deviance’. The case of Dr Ivan Toms' objection, a gay objector who wished to cite his sexuality as a primary motivation for his objection, reveals the unwillingness of the ECC to engage in sexual politics. Using Shane Phelan's and Zygmunt Bauman's concept of friends, enemies and strangers, this paper investigates the construction of both white gay men and white people who opposed apartheid as ‘strangers’ and suggests that the deployment of homophobia by the state was a stigmatizing discourse aimed at purging the ECC's political message from the public realm. In this context the ECC adopted an assimilatory discursive strategy, whereby they attempted to be ‘respectable whites’, negotiating over shared republican territory. This populist strategy, arguably safer in the short term, avoided issues of sexuality and the fundamental conflation of sexuality and citizenship in apartheid South Africa. The ECC thus circumscribed its radical and deconstructive political potential and did not offer a ‘radical democratic’ message in opposition to apartheid.

GIS technologies and spatial organization patterns among hunter-gatherers: an archaeological case study from Southern Patagonia (southern South America)

This paper discusses some aspects of hunter-gatherer spatial organization in southern South Patagonia, in later times to 10,000 cal yr BP. Various methods of spatial analysis, elaborated with a Geographic Information System (GIS) were applied to the distributional pattern of archaeological sites with radiocarbon dates. The shift in the distributional pattern of chronological information was assessed in conjunction with other lines of evidence within a biogeographic framework. Accordingly, the varying degrees of occupation and integration of coastal and interior spaces in human spatial organization are explained in association with the adaptive strategies hunter-gatherers have used over time. Both are part of the same human response to changes in risk and uncertainty variability in the region in terms of resource availability and environmental dynamics.

The Proceedings of the South Carolina Historical Association

Annually, the association publishes a journal, The Proceedings, which consists of papers presented at the annual meeting. Attorney General Isaac W. Hayne and the South Carolina Executive Council of 1862 by Lowry P. Ware Francis Warrington Dawson, 1840-1889 South Carolina Editor by S. Frank Logan Antonio Narino 1952, Precursor of Columbian Independence by Thomas Blossom

Leaf-, Panel- And Latex-expressed Sequenced Tags From The Rubber Tree (hevea Brasiliensis) Under Cold-stressed And Suboptimal Growing Conditions: The Development Of Gene-targeted Functional Markers For Stress Response.

Hevea brasiliensis is a native species of the Amazon Basin of South America and the primary source of natural rubber worldwide. Due to the occurrence of South American Leaf Blight disease in this area, rubber plantations have been extended to suboptimal regions. Rubber tree breeding is time-consuming and expensive, but molecular markers can serve as a tool for early evaluation, thus reducing time and costs. In this work, we constructed six different cDNA libraries with the aim of developing gene-targeted molecular markers for the rubber tree. A total of 8,263 reads were assembled, generating 5,025 unigenes that were analyzed; 912 expressed sequence tags (ESTs) represented new transcripts, and two sequences were highly up-regulated by cold stress. These unigenes were scanned for microsatellite (SSR) regions and single nucleotide polymorphisms (SNPs). In total, 169 novel EST-SSR markers were developed; 138 loci were polymorphic in the rubber tree, and 98 % presented transferability to six other Hevea species. Locus duplication was observed in H. brasiliensis and other species. Additionally, 43 SNP markers in 13 sequences that showed similarity to proteins involved in stress response, latex biosynthesis and developmental processes were characterized. cDNA libraries are a rich source of SSR and SNP markers and enable the identification of new transcripts. The new markers developed here will be a valuable resource for linkage mapping, QTL identification and other studies in the rubber tree and can also be used to evaluate the genetic variability of other Hevea species, which are valuable assets in rubber tree breeding.

Intrahippocampal Infusion Of Crotamine Isolated From Crotalus Durissus Terrificus Alters Plasma And Brain Biochemical Parameters.

Crotamine is one of the main constituents of the venom of the South American rattlesnake Crotalus durissus terrificus. Here we sought to investigate the inflammatory and toxicological effects induced by the intrahippocampal administration of crotamine isolated from Crotalus whole venom. Adult rats received an intrahippocampal infusion of crotamine or vehicle and were euthanized 24 h or 21 days after infusion. Plasma and brain tissue were collected for biochemical analysis. Complete blood count, creatinine, urea, glutamic oxaloacetic transaminase (GOT), glutamic pyruvic transaminase (GPT), creatine-kinase (CK), creatine kinase-muscle B (CK-MB) and oxidative parameters (assessed by DNA damage and micronucleus frequency in leukocytes, lipid peroxidation and protein carbonyls in plasma and brain) were quantified. Unpaired and paired t-tests were used for comparisons between saline and crotamine groups, and within groups (24 h vs. 21 days), respectively. After 24 h crotamine infusion promoted an increase of urea, GOT, GPT, CK, and platelets values (p ≤ 0.01), while red blood cells, hematocrit and leukocytes values decreased (p ≤ 0.01). Additionally, 21 days after infusion crotamine group showed increased creatinine, leukocytes, TBARS (plasma and brain), carbonyl (plasma and brain) and micronucleus compared to the saline-group (p ≤ 0.01). Our findings show that crotamine infusion alter hematological parameters and cardiac markers, as well as oxidative parameters, not only in the brain, but also in the blood, indicating a systemic pro-inflammatory and toxicological activity. A further scientific attempt in terms of preserving the beneficial activity over toxicity is required.

Revisão taxonômica de Myrocarpus Allemão (Leguminosae, Papilionoideae, Sophoreae)

In Myrocarpus, an exclusively South American genus, five species are recognised: Myrocarpus frondosus Allemão, M. leprosus Pickel, M. venezuelensis Rudd, M. fastigiatus Allemãoand M. emarginatus A.L.B. Sartori & A.M.G. Azevedo. Morphologic data, habitat information and geographic distribution of each taxon are discussed. Petal morphology and ornamentation of seed chamber are an important character for species identification, though not shown previously. Key to the species, descriptions, illustrations, distribution, and new registers are presented.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Remo : cargas concentradas de força e sua relação com a alteração de diferentes indicadores funcionais

Universidade Estadual de Campinas . Faculdade de Educação Física