Genetic Diversity Of Giardia Duodenalis: Multilocus Genotyping Reveals Zoonotic Potential Between Clinical And Environmental Sources In A Metropolitan Region Of Brazil.

Giardia duodenalis is a flagellate protozoan that parasitizes humans and several other mammals. Protozoan contamination has been regularly documented at important environmental sites, although most of these studies were performed at the species level. There is a lack of studies that correlate environmental contamination and clinical infections in the same region. The aim of this study is to evaluate the genetic diversity of a set of clinical and environmental samples and to use the obtained data to characterize the genetic profile of the distribution of G. duodenalis and the potential for zoonotic transmission in a metropolitan region of Brazil. The genetic assemblages and subtypes of G. duodenalis isolates obtained from hospitals, a veterinary clinic, a day-care center and important environmental sites were determined via multilocus sequence-based genotyping using three unlinked gene loci. Cysts of Giardia were detected at all of the environmental sites. Mixed assemblages were detected in 25% of the total samples, and an elevated number of haplotypes was identified. The main haplotypes were shared among the groups, and new subtypes were identified at all loci. Ten multilocus genotypes were identified: 7 for assemblage A and 3 for assemblage B. There is persistent G. duodenalis contamination at important environmental sites in the city. The identified mixed assemblages likely represent mixed infections, suggesting high endemicity of Giardia in these hosts. Most Giardia isolates obtained in this study displayed zoonotic potential. The high degree of genetic diversity in the isolates obtained from both clinical and environmental samples suggests that multiple sources of infection are likely responsible for the detected contamination events. The finding that many multilocus genotypes (MLGs) and haplotypes are shared by different groups suggests that these sources of infection may be related and indicates that there is a notable risk of human infection caused by Giardia in this region.

[strategies For Tackling Absenteeism In Dental Appointments In The Family Health Units Of A Large Municipality: Action Research].

The aim of this study was to analyze the reasons for missed appointments in dental Family Health Units (FHU) and implement strategies to reduce same through action research. This is a study conducted in 12 FHUs in Piracicaba in the State of São Paulo from January, 1 to December, 31 2010. The sample was composed of 385 users of these health units who were interviewed over the phone and asked about the reasons for missing dental appointments, as well as 12 dentists and 12 nurses. Two workshops were staged with professionals: the first to assess the data collected in interviews and develop strategy, and the second for evaluation after 4 months. The primary cause for missed appointments was the opening hours of the units coinciding with the work schedule of the users. Among the strategies suggested were lectures on oral health, ongoing education in team meetings, training of Community Health Agents, participation in therapeutic groups and partnerships between Oral Health Teams and the social infrastructure of the community. The adoption of the single medical record was the strategy proposed by professionals. The strategies implemented led to a 66.6% reduction in missed appointments by the units and the motivating nature of the workshops elicited critical reflection to redirect health practices.

Ecotoxicological Effects Of Carbofuran And Oxidised Multiwalled Carbon Nanotubes On The Freshwater Fish Nile Tilapia: Nanotubes Enhance Pesticide Ecotoxicity.

The interactions of carbon nanotubes with pesticides, such as carbofuran, classical contaminants (e.g., pesticides, polyaromatic hydrocarbons, heavy metals, and dyes) and emerging contaminants, including endocrine disruptors, are critical components of the environmental risks of this important class of carbon-based nanomaterials. In this work, we studied the modulation of acute carbofuran toxicity to the freshwater fish Nile tilapia (Oreochromis niloticus) by nitric acid treated multiwalled carbon nanotubes, termed HNO3-MWCNT. Nitric acid oxidation is a common chemical method employed for the purification, functionalisation and aqueous dispersion of carbon nanotubes. HNO3-MWCNT were not toxic to Nile tilapia at concentrations ranging from 0.1 to 3.0 mg/L for exposure times of up to 96 h. After 24, 48, 72 and 96 h, the LC50 values of carbofuran were 4.0, 3.2, 3.0 and 2.4 mg/mL, respectively. To evaluate the influence of carbofuran-nanotube interactions on ecotoxicity, we exposed the Nile tilapia to different concentrations of carbofuran mixed together with a non-toxic concentration of HNO3-MWCNT (1.0 mg/L). After 24, 48, 72, and 96 h of exposure, the LC50 values of carbofuran plus nanotubes were 3.7, 1.6, 0.7 and 0.5 mg/L, respectively. These results demonstrate that HNO3-MWCNT potentiate the acute toxicity of carbofuran, leading to a more than five-fold increase in the LC50 values. Furthermore, the exposure of Nile tilapia to carbofuran plus nanotubes led to decreases in both oxygen consumption and swimming capacity compared to the control. These findings indicate that carbon nanotubes could act as pesticide carriers affecting fish survival, metabolism and behaviour.

Trends and strategies of ozone application in environmental problems

Efforts presented by the scientific community in recent years towards the development of numerous green chemical processes and wastewater treatment technologies are presented and discussed. In the light of these approaches, environmentally friendly technologies, as well as the key role played by the well-known advanced oxidation processes, are discussed, giving special attention to the ones comprising ozone applications. Fundamentals and applied aspects dealing with ozone technology and its application are also presented.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Auto-eficácia docente e motivação para a realização do(a) professor(a) de Educação Física Adaptada

Universidade Estadual de Campinas . Faculdade de Educação Física

Analise da auto-eficacia docente de professores de educação fisica

Universidade Estadual de Campinas . Faculdade de Educação Física

Manejando o lazer em areas de potencial ecoturistico : o caso do Colegio Agricola de Jundiai/RN

Universidade Estadual de Campinas . Faculdade de Educação Física

Survival and quality of life of patients with oral and oropharyngeal cancer at 1-year follow-up of tumor resection

OBJECTIVE: This study aimed to assess the survival and life quality evolution of patients subjected to surgical excision of oral and oropharyngeal squamous cell carcinoma. MATERIAL AND METHODS: Forty-seven patients treated at a Brazilian healthcare unit specialized in head and neck surgery between 2006 and 2007 were enrolled in the study. The gathering of data comprised reviewing hospital files and applying the University of Washington Quality of Life (UW-QOL) questionnaire previously and 1 year after the surgery. Comparative analysis used Poisson regression to assess factors associated with survival and a paired t-test to compare preoperative and 1-year postoperative QOL ratings. RESULTS: 1 year after surgery, 7 patients were not found (dropout of the cohort); 15 had died and 25 fulfilled the UW-QOL again. The risk of death was associated with having regional metastasis previously to surgery (relative risk=2.18; 95% confidence interval=1.09-5.17) and tumor size T3 or T4 (RR=2.30; 95%CI=1.05-5.04). Survivors presented significantly (p<0.05) poorer overall and domain-specific ratings of quality of life. Chewing presented the largest reduction: from 74.0 before surgery to 34.0 one year later. Anxiety was the only domain whose average rating increased (from 36.0 to 70.7). CONCLUSIONS: The prospective assessment of survival and quality of life may contribute to anticipate interventions aimed at reducing the incidence of functional limitations in patients with oral and oropharyngeal cancer.

Estressores em Unidade de Terapia Intensiva: versão brasileira do The Environmental Stressor Questionnaire

Este estudo teve como objetivo realizar a adaptação cultural do The Environmental Stressor Questionnaire - (ESQ) para a língua portuguesa do Brasil e verificar sua confiabilidade e validade. Foram empregadas as etapas metodológicas recomendadas pela literatura para adaptação cultural. A versão brasileira do ESQ foi aplicada a 106 pacientes de Unidade de Terapia Intensiva (UTI) de dois hospitais, público e privado, do interior do Estado de São Paulo. A confiabilidade foi avaliada quanto à consistência interna e estabilidade (teste e reteste); a validade convergente foi verificada por meio da correlação entre o ESQ e questão genérica sobre estresse em UTI. A confiabilidade foi satisfatória com Alfa de Crombach=0,94 e Coeficiente de Correlação Intraclasse=0,861 (IC95% 0,723; 0,933). Constatou-se correlação entre o escore total do ESQ e a questão genérica sobre estresse (r=0,70), confirmando a validade convergente. A versão brasileira do ESQ mostrou-se uma ferramenta confiável e válida para avaliação de estressores em UTI.

The role of pH on the survival of rumen protozoa in steers

In order to study the effect of pH on defaunation in the rumen, four rumen fistulated steers were fed a basal roughage diet for a 4-week adaptation period followed by 17 weeks of feeding with three diets and two feeding levels of high concentrate diet. Rumen outflow fluid rate was evaluated in both ration levels. Rumen protozoa population was monitored weekly and when animals became defaunated, protozoa were reinoculated with rumen contents from one of the faunated steers. At every two weeks, during all the experimental period, rumen pH was measured in all animals at 0, 4, 8 and 12 h after feeding. It was observed an individual animal influence on the establishment and maintenance of the rumen ciliate protozoa population. In all sampling times, mean rumen pH values were higher in faunated steers than in the defaunated ones. No differences were observed in rumen outflow fluid rates between the two ration levels. Extended periods of low rumen pH are probably more detrimental to the survival of ciliate protozoa in the rumen than other factors.

Induced spawning of the endangered Neotropical species Steindachneridion parahybae (Siluriformes: Pimelodidae)

The "surubim do Paraíba" (Steindachneridion parahybae) is a freshwater catfish endemic to the Paraíba do Sul River basin, Brazil. This species has been seriously threatened by environmental disturbances in the last several decades. Wild Steindachneridion parahybae males and females were collected in 2003 and taken to the hatchery of a power plant of the Companhia Energética de São Paulo (CESP). Steindachneridion parahybae broodstocks were artificially induced to reproduce in December 2003 using a combination of carp pituitary extract (CPE) and human chorionic gonadotropin (hCG). Oocytes and milt were stripped; the fertilized eggs were transferred to 60-liter conical incubators and hatched larvae distributed in nine horizontal trays. Exogenous feed was started just after yolk sac absorption. A high rate of cannibalism and photophobia were observed during the larval period, resulting in a 26% survival rate from larvae to fingerlings.

Effects of temperature and salinity on the survival rates of coxicerberus ramosae (Albuquerque, 1978), an interstitial isopod of a Sandy Beach on the coast of Brazil

The tolerance to the combined effects of temperature and salinity was investigated in the interstitial isopod Coxicerberus ramosae (Albuquerque, 1978), a species of intertidal zone of sandy beaches in Rio de Janeiro, Brazil. The animals were collected on Praia Vermelha Beach. The experiments lasted 24 h and nine salinities and seven temperatures were used for a total of 63 combinations. Thirty animals were tested in each combination. The species showed high survival in most of the combinations. The temperature of 35 ºC was lethal and at 5 ºC, the animals tolerated only a narrow range of salinities. The statistical analyses showed that the effects of temperature and salinity were significant on the survival, which confirmed the euryhalinity and eurythermy of this species.

Stress-induced neuroinflammation: mechanisms and new pharmacological targets

Stress is triggered by numerous unexpected environmental, social or pathological stimuli occurring during the life of animals, including humans, which determine changes in all of their systems. Although acute stress is essential for survival, chronic, long-lasting stress can be detrimental. In this review, we present data supporting the hypothesis that stress-related events are characterized by modifications of oxidative/nitrosative pathways in the brain in response to the activation of inflammatory mediators. Recent findings indicate a key role for nitric oxide (NO) and an excess of pro-oxidants in various brain areas as responsible for both neuronal functional impairment and structural damage. Similarly, cyclooxygenase-2 (COX-2), another known source of oxidants, may account for stress-induced brain damage. Interestingly, some of the COX-2-derived mediators, such as the prostaglandin 15d-PGJ2 and its peroxisome proliferator-activated nuclear receptor PPARγ, are activated in the brain in response to stress, constituting a possible endogenous anti-inflammatory mechanism of defense against excessive inflammation. The stress-induced activation of both biochemical pathways depends on the activation of the N-methyl-D-aspartate (NMDA) glutamate receptor and on the activation of the transcription factor nuclear factor kappa B (NFκB). In the case of inducible NO synthase (iNOS), release of the cytokine TNF-α also accounts for its expression. Different pharmacological strategies directed towards different sites in iNOS or COX-2 pathways have been shown to be neuroprotective in stress-induced brain damage: NMDA receptor blockers, inhibitors of TNF-α activation and release, inhibitors of NFκB, specific inhibitors of iNOS and COX-2 activities and PPARγ agonists. This article reviews recent contributions to this area addressing possible new pharmacological targets for the treatment of stress-induced neuropsychiatric disorders.

Multivariate analysis of the effects of soil parameters and environmental factors on the flavonoid content of leaves of Passiflora incarnata L., Passifloraceae

The aim of the present study was to evaluate the effect of soil characteristics (pH, macro- and micro-nutrients), environmental factors (temperature, humidity, period of the year and time of day of collection) and meteorological conditions (rain, sun, cloud and cloud/rain) on the flavonoid content of leaves of Passiflora incarnata L., Passifloraceae. The total flavonoid contents of leaf samples harvested from plants cultivated or collected under different conditions were quantified by high-performance liquid chromatography with ultraviolet detection (HPLC-UV/PAD). Chemometric treatment of the data by principal component (PCA) and hierarchic cluster analyses (HCA) showed that the samples did not present a specific classification in relation to the environmental and soil variables studied, and that the environmental variables were not significant in describing the data set. However, the levels of the elements Fe, B and Cu present in the soil showed an inverse correlation with the total flavonoid contents of the leaves of P. incarnata.