999 resultados para Conselho Nacional de Justiça (Brasil) (CNJ)
Resumo:
This survey aimed at describing the interactions of floral visitors and Davilla kunthii A. St.-Hil. as well as characteristics of its reproductive biology in Itacoatiara, state of Amazonas, Brazil. Tests of the breeding system were performed. The guild of visitors was described according to richness, abundance, relative frequency and constancy. The breeding system tests indicated that D. kunthii is self-compatible. The pollination system was characterized as generalist, with 39 visitor species, from three different orders. Bees were the main group of pollinators, thus some behavioural aspects were described. Th e period of highest foraging activity was between 7 and 10 am. Some species presented agonistic and monopolistic behaviour. Given the behaviour and destructive potential, the Curculionidae seem to have a greater impact as seed predators than pollinators.
Resumo:
Size distributions in woody plant populations have been used to assess their regeneration status, assuming that size structures with reverse-J shapes represent stable populations. We present an empirical approach of this issue using five woody species from the Cerrado. Considering count data for all plants of these five species over a 12-year period, we analyzed size distribution by: a) plotting frequency distributions and their adjustment to the negative exponential curve and b) calculating the Gini coefficient. To look for a relationship between size structure and future trends, we considered the size structures from the first census year. We analyzed changes in number over time and performed a simple population viability analysis, which gives the mean population growth rate, its variance and the probability of extinction in a given time period. Frequency distributions and the Gini coefficient were not able to predict future trends in population numbers. We recommend that managers should not use measures of size structure as a basis for management decisions without applying more appropriate demographic studies.
Resumo:
The aim of this work was to evaluate the floristic composition, richness, and diversity of the upper and lower strata of a stretch of mixed rain forest near the city of Itaberá, in southeastern Brazil. We also investigated the differences between this conservation area and other stretches of mixed rain forest in southern and southeastern Brazil, as well as other nearby forest formations, in terms of their floristic relationships. For our survey of the upper stratum (diameter at breast height [DBH] > 15 cm), we established 50 permanent plots of 10 × 20 m. Within each of those plots, we designated five, randomly located, 1 × 1 m subplots, in order to survey the lower stratum (total height > 30 cm and DBH < 15 cm). In the upper stratum, we sampled 1429 trees and shrubs, belonging to 134 species, 93 genera, and 47 families. In the lower stratum, we sampled 758 trees and shrubs, belonging to 93 species, 66 genera, and 39 families. In our floristic and phytosociological surveys, we recorded 177 species, belonging to 106 genera and 52 families. The Shannon Diversity Index was 4.12 and 3.5 for the upper and lower strata, respectively. Cluster analysis indicated that nearby forest formations had the strongest floristic influence on the study area, which was therefore distinct from other mixed rain forests in southern Brazil and in the Serra da Mantiqueira mountain range.
Resumo:
We analyzed the structure of the understory community in the Atlantic Forest sensu lato, for which phytosociological descriptions of the understory are lacking. We delineated 50 plots of 10 × 20 m each at four sites within an Araucaria forest (a subtype of Atlantic Forest), located in the municipalities of Bananal, Campos do Jordão, Itaberá and Barra do Chapéu, all of which are in the state of São Paulo, Brazil. To sample the resident species of the understory, we randomly selected five 1 × 1 m subplots within each plot, resulting in a total sampling area of 250 m² at each site. We identified differences among the locations, mostly due to proportional differences in growth forms, in terms of species richness and the importance values within the community. Factors potentially influencing the understory structure include macroclimatic and microclimatic conditions, as well as forest fragmentation, the abundance of deciduous trees in the canopy, the surrounding vegetation and geographic location.
Resumo:
Losses of horticulture product in Brazil are significant and among the main causes are the use of inappropriate boxes and the absence of a cold chain. A project for boxes is proposed, based on computer simulations, optimization and experimental validation, trying to minimize the amount of wood associated with structural and ergonomic aspects and the effective area of the openings. Three box prototypes were designed and built using straight laths with different configurations and areas of openings (54% and 36%). The cooling efficiency of Tommy Atkins mango (Mangifera Indica L.) was evaluated by determining the cooling time for fruit packed in the wood models and packed in the commercially used cardboard boxes, submitted to cooling in a forced-air system, at a temperature of 6ºC and average relative humidity of 85.4±2.1%. The Finite Element Method was applied, for the dimensioning and structural optimization of the model with the best behavior in relation to cooling. All wooden boxes with fruit underwent vibration testing for two hours (20 Hz). There was no significant difference in average cooling time in the wooden boxes (36.08±1.44 min); however, the difference was significant in comparison to the cardboard boxes (82.63±29.64 min). In the model chosen for structural optimization (36% effective area of openings and two side laths), the reduction in total volume of material was 60% and 83% in the cross section of the columns. There was no indication of mechanical damage in the fruit after undergoing the vibration test. Computer simulations and structural study may be used as a support tool for developing projects for boxes, with geometric, ergonomic and thermal criteria.
Resumo:
A new species of dactylogyrid monogenean, Apedunculata discoidea gen. n., sp. n. is described and illustrated from the gills of the freshwater fish Prochilodus lineatus (Valenciennes, 1837) in pisciculture ponds from Pirassununga, São Paulo, Brazil. Diagnostic characters of the new genus and species are: 1) vagina dextrolateral slightly sclerotised, opening anteriorly at level of copulatory complex; 2) copulatory organ coiled with two counterclockwise rings; 3) Accessory piece distal and not articulated; 4) body disk-shaped, lacking a peduncle.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
PURPOSE: To evaluate the prevalence of pterygium in a population-based sample at Botucatu City - São Paulo State, Brazil. METHODS: A population-based cross-sectional study with randomized clustered sampling of households was conducted in the urban area of the Botucatu City -São Paulo State, Brazil and 85.1% of the intended sample was evaluated. All participants were submitted to ophthalmologic examination and the data were statistically analyzed. RESULTS: The prevalence of pterygium lesion in Botucatu City was 8.12% (7.0% < CI < 9.2%), affecting mainly males (10.4% males X 6.5% females - 8.5% < CI < 12.3% for males and 5.1% < CI < 7.8% for females) with 49.6 ± 14.9 years old in average; 32.18% of the pterygium carriers aged between 40 and 50 years. CONCLUSIONS: The prevalence of pterygium at Botucatu is 8.12%, affecting most frequently 40-50 year-old males.
Resumo:
En este trabajo fueron determinados experimentalmente el calor específico, conductividad térmica, difusividad térmica y densidad del jugo de lulo en el rango de contenido de agua de 0.55 a 0.90 (p/p en base húmeda) y en temperaturas variando de 4 a 78.6 °C. La conductividad térmica y el calor específico fueron obtenidos utilizando el mismo aparato - una célula constituida de dos cilindros concéntricos - operando en estado estacionario y no- estacionario, respectivamente. La difusividad térmica fue obtenida a través del método de Dickerson y la densidad determinada por picnometria. Tanto la temperatura como el contenido de agua presentaron una fuerte influencia en los datos experimentales de las propiedades termofísicas del jugo de lulo. Los resultados obtenidos fueron utilizados para obtener modelos matemáticos y predecir estas propiedades en función de la concentración y la temperatura.
Resumo:
This work evaluated the effects of Tris (hydroxymethyl)-aminomethane (TRIS) buffer and its interaction with nutrient concentration on the development of Gracilaria birdie, a common species on the Brazilian coast that has been exploited for agar production. Responses to different conditions were assessed through growth rates and pigment content (chlorophyll a, phycoerythrin, phycocyanin and allophycocyanin). Provasoli's nutrient solution with and without TRIS addition was tested at concentrations of 12.5, 25 and 50%. The pH was also monitored. G. birdiae grew better in the absence of TRIS and at low nutrient concentrations, 12.5 and 25% (growth rates of 10.8-11.3%.day-1). Higher contents of phycoerythrin and chlorophyll a were observed without TRIS at 12.5 and 25% (Phycoerythrin, 649.6-698.0 μg g-1 fresh biomass; Chlorophyll a, 156.0-168.6 μg g-1 fresh biomass). These findings highlight the deleterious effect of TRIS on growth and phycoerythrin and chlorophyll a content. They also demonstrate the importance of appropriate nutrient concentration for laboratory cultures, depending on the intrinsic characteristics of each species.
Resumo:
Pimelerodius punctiventris sp. nov. (type locality Brazil, Amazonas, Itacoatiara) is described and illustrated. The new taxon is compared with similar species, being distinguished from the other 12 known species of the genus by the presence of punctures in ventrite I. The available published key for identification of species of Pimelerodius is adapted to include the new species. A modification of the generic description of the aedeagus of Pimelerodius is provided, a necessity due to the differences observed in the aedeagus of the new species. The occurrence of P. motacilla (Boheman, 1843) in the Amazon Region, recorded in sympatry with P. punctiventris in Itacoatiara, AM, is discussed and confirmed, based on the study of 41 available specimens.
Resumo:
Diapoma is reviewed and four species are recognized: (1) Diapoma thauma, new species, from streams of the rio Jacuí basin, state of Rio Grande do Sul; (2) D. pyrrhopteryx, new species collected from the rio Canoas and streams flowing into this basin in the states of Rio Grande do Sul and Santa Catarina, Brazil; (3) Diapoma terofali, from streams flowing into rio Uruguay in Uruguay and Rio Grande do Sul, Brazil and streams flowing into rio de la Plata, Argentina; and (4) Diapoma speculiferum, from lowland coastal streams in Rio Grande do Sul, Brazil and Uruguay. Diapoma pyrrhopteryx possess the posteroventral opercular elongation typical of D. speculiferum, type species of the genus, but which is absent in D. thauma and D. terofali. Nonetheless, all the diapomin species have the caudal pouch organ about equally developed in both sexes and the dorsal portion of the pouch opening bordered by a series of 3 to 8 elongated scales, the two derived features that characterize the group. The two previously described species, D. speculiferum and D. terofali, are redescribed. Previous hypotheses of relationships among the diapomin genera Planaltina, Diapoma and Acrobrycon are discussed on the basis of preliminary morphological information. It is proposed that the Diapomini is a monophyletic group. An identification key, information on sexual dimorphism, gonad anatomy, reproductive mode and distribution of the species of Diapoma are provided.
Resumo:
The systematics of the Glandulocaudinae is reviewed in detail and justification for the recognition of the group as a subfamily is discussed. The subfamily Glandulocaudinae consists of three genera: Lophiobrycon with one species plesiomorphic in some anatomical features but some others exclusively derived relative to the species in the other genera; Glandulocauda with two species intermediate in phylogenetic derivation; and Mimagoniates with seven species (one new), all more phylogenetically derived concerning their pheromone producing caudal-fin organs and with other anatomical characters presumably more derived than in the species of the other genera. Glandulocauda melanogenys Eigenmann, 1911, is considered a junior synonym of Hyphessobrycon melanopleurus Ellis, 1911. A replacement name, Glandulocauda caerulea Menezes & Weitzman, is proposed for G. melanopleura Eigenmann, 1911. Gland cells found in the caudal-fin organs of all species are histologically indistinguishable from club cells and probably secrete a pheromone during courtship. The club cells are associated with somewhat modified to highly derived caudal scales forming a pheromone pumping organ in the more derived genera and species. This subfamily is distributed in freshwaters of eastern and southern Brazil, Paraguay, and northeastern Uruguay.
Resumo:
Protimesius osvaldoi sp. nov. is described from the Reserva Biológica de Sooretama, state of Espírito Santo, southeastern Brazil, being the first record of Stygnidae from this State and the southernmost record of the family in the Brazilian Atlantic Forest (hitherto, the family was recorded down to Bahia only), extending in 210 km south of the previously known distribution. This is a large species, with armature of leg IV very reduced and penial morphology differing from the closest counterparts mainly in the ventral plate, which recedes deeply at the lateral borders and has the distal margin curved ventrally and by the presence of two small intermediate setae. Protimesius Roewer, 1913 consisted hitherto of 17 species, recorded from northern/northeastern Brazil and Amazonia of adjacent countries. A key is given for the 17 species of Protimesius for which males are known.
Resumo:
Croton celtidifolius Baill is a tree found in the Atlantic Forest South of Brazil, mainly in Santa Catarina. The bark and leaf infusions of this medicinal plant have been popularly used for the treatment of inflammatory diseases. The anti-aggregant activity of C. celtidifolius crude extract (CE) and the column chromatography (CC) isolated compounds flavonoids, catechin and gallocatechin were evaluated in human blood platelets. The platelet-rich plasma (PRP) was incubated with different concentrations of flavonóides (50 - 200 µg/mL) to be tested before platelet aggregation was induced by the agonists adenosine 5'diphosphate (ADP) and collagen. At 200 µg/mL the CE, catechin and gallocatechin markedly inhibited platelet aggregation with the aggregant agents. Using ATP production as an index of platelet secretory capacity, we observed a decreased production of ATP in platelets treated with flavonoids when stimulated by collagen. On the other hand, the flavonoids did not promote inhibitory effect on prothrombin time (PT), thromboplastin time (APTT) and thrombin time (TT). In conclusion, these observations suggest that C. celtidifolius is likely to exert an inhibitory action on platelets in vitro by suppressing secretion and platelet aggregation.