Cell acidification in apoptosis: granulocyte colony-stimulating factor delays programmed cell death in neutrophils by up-regulating the vacuolar H(+)-ATPase.

Neutrophils in tissue culture spontaneously undergo programmed cell death (apoptosis), a process characterized by well-defined morphological alterations affecting the cell nucleus. We found that these morphological changes were preceded by intracellular acidification and that acidification and the apoptotic changes in nuclear morphology were both delayed by granulocyte colony-stimulating factor (G-CSF). Among the agents that defend neutrophils against intracellular acidification is a vacuolar H(+)-ATPase that pumps protons out of the cytosol. When this proton pump was inhibited by bafilomycin A1, G-CSF no longer protected the neutrophils against apoptosis. We conclude that G-CSF delays apoptosis in neutrophils by up-regulating the cells' vacuolar H(+)-ATPase and that intracellular acidification is an early event in the apoptosis program.

Stimulation of human monocytes with macrophage colony-stimulating factor induces a Grb2-mediated association of the focal adhesion kinase pp125FAK and dynamin.

Macrophage colony-stimulating factor (M-CSF) is required for the growth and differentiation of mononuclear phagocytes. In the present studies using human monocytes, we show that M-CSF induces interaction of the Grb2 adaptor protein with the focal adhesion kinase pp125FAK. The results demonstrate that tyrosine-phosphorylated pp125FAK directly interacts with the SH2 domain of Grb2. The findings indicate that a pYENV site at Tyr-925 in pp125FAK is responsible for this interaction. We also demonstrate that the Grb2-FAK complex associates with the GTPase dynamin. Dynamin interacts with the SH3 domains of Grb2 and exhibits M-CSF-dependent tyrosine phosphorylation in association with pp125FAK. These findings suggest that M-CSF-induced signaling involves independent Grb2-mediated pathways, one leading to Ras activation and another involving pp125FAK and a GTPase implicated in receptor internalization.

Macrophage-colony-stimulating factor regulates expression of the integrins alpha 4 beta 1 and alpha 5 beta 1 by murine bone marrow macrophages.

We observed that when monocyte/macrophage precursors derived from murine bone marrow were treated with macrophage-colony-stimulating factor (M-CSF), there was a dose-dependent increase in both the number of adherent cells and the degree to which the cells were highly spread. Attachment was supported by fibronectin, but not by vitronectin or laminin, suggesting that the integrins alpha 4 beta 1 and/or alpha 5 beta 1 might mediate this event. Binding to fibronectin was blocked partially by antibodies to either integrin, and inhibition was almost complete when the antibodies were used in combination. By a combination of surface labeling with 125I and metabolic labeling with [35S]methionine and [35S]cysteine, we demonstrated that M-CSF treatment led to increased synthesis and surface expression of the two beta 1 integrins. Since attachment to fibronectin and/or stromal cells plays an important role in the maturation of other hematopoietic lineages, we propose that the action of M-CSF in the differentiation of immature monocytes/macrophages includes stimulated expression of the integrins alpha 4 beta 1 and alpha 5 beta 1, leading to interactions with components of the marrow microenvironment necessary for cell maturation.

Pluripotent hematopoietic stem cells contain high levels of mRNA for c-kit, GATA-2, p45 NF-E2, and c-myb and low levels or no mRNA for c-fms and the receptors for granulocyte colony-stimulating factor and interleukins 5 and 7.

Pluripotent hematopoietic stem cells (PHSCs) were highly enriched from mouse bone marrow by counterflow centrifugal elutriation, lineage subtraction, and fluorescence-activated cell sorting based on high c-kit receptor expression (c-kitBR). We used reverse transcriptase polymerase chain reaction to assay the c-kitBR subset and the subsets expressing low (c-kitDULL) and no (c-kitNEG) c-kit receptor for expression of mRNA encoding hematopoietic growth factor receptors and transcription factors. The c-kitBR cells had approximately 3.5-fold more c-kit mRNA than unfractionated bone marrow cells. The c-kitDULL cells had 47-58% of the c-kit mRNA found in c-kitBR cells and the c-kitNEG cells had 4-9% of the c-kit mRNA present in c-kitBR cells. By comparing mRNA levels in c-kitBR cells (enriched for PHSCs) with those of unfractionated bone marrow, we demonstrated that c-kitBR cells contained low or undetectable levels of mRNA for c-fms, granulocyte colony-stimulating factor receptor, interleukin 5 receptor (IL-5R), and IL-7R. These same cells had moderate levels of mRNA for erythropoietin receptor, IL-3R subunits IL-3R alpha (SUT-1), AIC-2A, and AIC-2B, IL-6R and its partner gp-130, and the transcription factor GATA-1 and high levels of mRNA for transcription factors GATA-2, p45 NF-E2, and c-myb. We conclude from these findings that PHSCs are programmed to interact with stem cell factor, IL-3, and IL-6 but not with granulocyte or macrophage colony-stimulating factor. These findings also indicate that GATA-2, p45 NF-E2, and c-myb activities may be involved in PHSC maintenance or proliferation.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Splitting complex temporal questions for question answering systems

This paper presents a multi-layered Question Answering (Q.A.) architecture suitable for enhancing current Q.A. capabilities with the possibility of processing complex questions. That is, questions whose answer needs to be gathered from pieces of factual information scattered in different documents. Specifically, we have designed a layer oriented to process the different types of temporal questions. Complex temporal questions are first decomposed into simpler ones, according to the temporal relationships expressed in the original question. In the same way, the answers of each simple question are re-composed, fulfilling the temporal restrictions of the original complex question. Using this architecture, a Temporal Q.A. system has been developed. In this paper, we focus on explaining the first part of the process: the decomposition of the complex questions. Furthermore, it has been evaluated with the TERQAS question corpus of 112 temporal questions. For the task of question splitting our system has performed, in terms of precision and recall, 85% and 71%, respectively.

Spin splitting in a polarized quasi-two-dimensional exciton gas

We have observed a large spin splitting between "spin" +1 and -1 heavy-hole excitons, having unbalanced populations, in undoped GaAs/AlAs quantum wells in the absence of any external magnetic field. Time-resolved photoluminescence spectroscopy, under excitation with circularly polarized light, reveals that, for high excitonic density and short times after the pulsed excitation, the emission from majority excitons lies above that of minority ones. The amount of the splitting, which can be as large as 50% of the binding energy, increases with excitonic density and presents a time evolution closely connected with the degree of polarization of the luminescence. Our results are interpreted on the light of a recently developed model, which shows that, while intraexcitonic exchange interaction is responsible for the spin relaxation processes, exciton-exciton interaction produces a breaking of the spin degeneracy in two-dimensional semiconductors.

Sol–gel copper chromium delafossite thin films as stable oxide photocathodes for water splitting

Significant effort is being devoted to the study of photoactive electrode materials for artificial photosynthesis devices. In this context, photocathodes promoting water reduction, based on earth-abundant elements and possessing stability under illumination, should be developed. Here, the photoelectrochemical behavior of CuCrO2 sol–gel thin film electrodes prepared on conducting glass is presented. The material, whose direct band gap is 3.15 eV, apparently presents a remarkable stability in both alkaline and acidic media. In 0.1 M HClO4 the material is significantly photoactive, with IPCE values at 350 nm and 0.36 V vs. RHE of over 6% for proton reduction and 23% for oxygen reduction. This response was obtained in the absence of charge extraction layers or co-catalysts, suggesting substantial room for optimization. The photocurrent onset potential is equal to 1.06 V vs. RHE in both alkaline and acidic media, which guarantees the combination of the material with different photoanodes such as Fe2O3 or WO3, potentially yielding bias-free water splitting devices.

Large spin splitting in the conduction band of transition metal dichalcogenide monolayers

We study the conduction band spin splitting that arises in transition metal dichalcogenide (TMD) semiconductor monolayers such as MoS2, MoSe2, WS2, and WSe2 due to the combination of spin-orbit coupling and lack of inversion symmetry. Two types of calculation are done. First, density functional theory (DFT) calculations based on plane waves that yield large splittings, between 3 and 30 meV. Second, we derive a tight-binding model that permits to address the atomic origin of the splitting. The basis set of the model is provided by the maximally localized Wannier orbitals, obtained from the DFT calculation, and formed by 11 atomiclike orbitals corresponding to d and p orbitals of the transition metal (W, Mo) and chalcogenide (S, Se) atoms respectively. In the resulting Hamiltonian, we can independently change the atomic spin-orbit coupling constant of the two atomic species at the unit cell, which permits to analyze their contribution to the spin splitting at the high symmetry points. We find that—in contrast to the valence band—both atoms give comparable contributions to the conduction band splittings. Given that these materials are most often n-doped, our findings are important for developments in TMD spintronics.

List of books donated by Francis Bernard, Governor of the Massachusetts Bay Colony, undated

Bracketed annotation made by John Langdon Sibley in Feb. 1842: "The books on this & the three succeeding pages, I find on examination, to have been given by Gov. Bernard." On the fourth page, presumably also in 1842, Sibley wrote: "This is a list of donations by Gov. Bernard, & not by Hollis."

Motion for change of venue in the case of the Inhabitants of Massachusetts Bay Colony v. Charles Paxton, October 1761

A motion that the case not be tried in Suffolk County, on the grounds that the judges and jurors were residents of the colony. Pratt was attorney to Paxton, an attorney and commissioner of customs, who had incurred a debt to the Colony.

An elegie on the deplored decease of that truly pious and religious matron, Mrs. Sara Leveret: relict of the late hon[or]able John Leveret, Esq., sometime governor of his then Majesty's colony of the Massethusets [sic] Bay in New England : manuscript, 1704

Autograph copy, signed.