An exploration of female leadership language:case studies of senior women in Bahrain

This is a multiple case study of the leadership language of three senior women working in a large corporation in Bahrain. The study’s main aim is to explore the linguistic practices the women leaders use with their colleagues and subordinates in corporate meetings. Adopting a Foucauldian (1972) notion of ‘discourses’ as social practices and a view of gender as socially constructed and discursively performed (Butler 1990), this research aims to unveil the competing discourses which may shape the leadership language of senior women in their communities of practice. The research is situated within the broader field of Sociolinguistics and the specific field of Language and Gender. To address the research aim, a case study approach incorporating multiple methods of qualitative data collection (observation, interviews, and shadowing) was utilised to gather information about the three women leaders and produce a rich description of their use of language in and out of meeting contexts. For analysis, principles of Qualitative Data Analysis (QDA) were used to organise and sort the large amount of data. Also, Feminist Post- Structuralist Discourse Analysis (FPDA) was adopted to produce a multi-faceted analysis of the subjects, their language leadership, power relations, and competing discourses in the context. It was found that the three senior women enact leadership differently making variable use of a repertoire of conventionally masculine and feminine linguistic practices. However, they all appear to have limited language resources and even more limiting subject positions; and they all have to exercise considerable linguistic expertise to police and modify their language in order to avoid the ‘double bind’. Yet, the extent of this limitation and constraints depends on the community of practice with its prevailing discourses, which appear to have their roots in Islamic and cultural practices as well as some Western influences acquired throughout the company’s history. It is concluded that it may be particularly challenging for Middle Eastern women to achieve any degree of equality with men in the workplace because discourses of Gender difference lie at the core of Islamic teaching and ideology.

Tissue-specific selection of reference genes is required for expression studies in the mouse model of maternal protein undernutrition

Suboptimal maternal nutrition during gestation results in the establishment of long-term phenotypic changes and an increased disease risk in the offspring. To elucidate how such environmental sensitivity results in physiological outcomes, the molecular characterisation of these offspring has become the focus of many studies. However, the likely modification of key cellular processes such as metabolism in response to maternal undernutrition raises the question of whether the genes typically used as reference constants in gene expression studies are suitable controls. Using a mouse model of maternal protein undernutrition, we have investigated the stability of seven commonly used reference genes (18s, Hprt1, Pgk1, Ppib, Sdha, Tbp and Tuba1) in a variety of offspring tissues including liver, kidney, heart, retro-peritoneal and inter-scapular fat, extra-embryonic placenta and yolk sac, as well as in the preimplantation blastocyst and blastocyst-derived embryonic stem cells. We find that although the selected reference genes are all highly stable within this system, they show tissue, treatment and sex-specific variation. Furthermore, software-based selection approaches rank reference genes differently and do not always identify genes which differ between conditions. Therefore, we recommend that reference gene selection for gene expression studies should be thoroughly validated for each tissue of interest. © 2011 Elsevier Inc.

Where do bright ideas occur in our brain? Meta-analytic evidence from neuroimaging studies of domain-specific creativity

Many studies have assessed the neural underpinnings of creativity, failing to find a clear anatomical localization. We aimed to provide evidence for a multi-componential neural system for creativity. We applied a general activation likelihood estimation (ALE) meta-analysis to 45 fMRI studies. Three individual ALE analyses were performed to assess creativity in different cognitive domains (Musical, Verbal, and Visuo-spatial). The general ALE revealed that creativity relies on clusters of activations in the bilateral occipital, parietal, frontal, and temporal lobes. The individual ALE revealed different maximal activation in different domains. Musical creativity yields activations in the bilateral medial frontal gyrus, in the left cingulate gyrus, middle frontal gyrus, and inferior parietal lobule and in the right postcentral and fusiform gyri. Verbal creativity yields activations mainly located in the left hemisphere, in the prefrontal cortex, middle and superior temporal gyri, inferior parietal lobule, postcentral and supramarginal gyri, middle occipital gyrus, and insula. The right inferior frontal gyrus and the lingual gyrus were also activated. Visuo-spatial creativity activates the right middle and inferior frontal gyri, the bilateral thalamus and the left precentral gyrus. This evidence suggests that creativity relies on multi-componential neural networks and that different creativity domains depend on different brain regions.

The influence of perception of forgetting and gender, ethnicity, and closeness on likelihood of caregiving

As life expectancy increases, the population of older adults is increasing rapidly. The caregiving of older parents by adult children has become a normative experience. Much of the gerontological literature has examined the caregiving experience, particularly in terms of the stresses involved. However, research is only beginning to examine the factors which motivate adult children to begin caregiving. The research described here examined how an elderly parent's memory behavior might influence caregiving decisions. In addition, gender, ethnicity, and parent-adult child closeness were examined to explore how these individual difference variables might influence those caregiving decisions.^ Participants read one of two vignettes describing a social visit with an elderly widow (target). In the vignette, the elderly target experiences several instances of forgetting. The vignettes depicted forgetting behavior established in pilot work as normal or serious. The normal forgetting vignette did not arouse concern and the serious forgetting vignette did arouse concern when the middle-aged participants imagined their mothers in the role of the vignette target. Participants rated their likelihood of engaging in eight caregiving behaviors if their mothers behaved like the vignette target. They also rated their closeness with their own mothers.^ Multivariate analyses of variance indicated main effects for vignette type, gender, ethnicity, and attachment. The likelihood of caregiving was higher when forgetting was more serious and when participants were female, Hispanic, and were highly attached to their mothers. Interaction effects showed that gender differences decreased with increased seriousness of forgetting, and ethnic differences were only significant for the normal forgetting condition.^ Multiple regression analyses indicated that attachment was the most significant predictor of likelihood of caregiving. Gender and ethnicity predicted specific caregiving behaviors. Females were more likely to engage in phoning and cooking, and Hispanics were more likely to engage in visiting and suggesting mother move in. ^

Filtering the international gender paradigm: Perspectives of gender in Barbados

My work presents a place-specific analysis of how gender paradigms interact across and within spatial scales: the global, the regional, the national and the personal. It briefly outlines the concepts and measures defining the international gender paradigm, and explores the filtration of this paradigm into assessments and understandings of gender and gender dynamics by and within Barbados. It does this by analyzing the contents of reports of the Barbados government to international bodies assessing the country’s performance in the area of gender equality, and by analyzing gender-comparative content of local print news media over the decade of the 1990s, and the first decade of the 2000s. It contextualizes the discussion within the realm of social and economic development. The work shows how the almost singular focus on “women” in the international gender paradigm may depreciate valid gender concerns of men and thus hinder the overall goal of achieving gender equality, that is, achieving just, inclusive societies.

Specific binding of the mammalian high mobility group protein AT-hook 2 to the minor groove of AT -rich DNAs: Thermodynamic and specificity studies

The mammalian high mobility group protein AT-hook 2 (HMGA2) is a small transcriptional factor involved in cell development and oncogenesis. It contains three "AT-hook" DNA binding domains, which specifically recognize the minor groove of AT-rich DNA sequences. It also has an acidic C-terminal motif. Previous studies showed that HMGA2 mediates all its biological effects through interactions with AT-rich DNA sequences in the promoter regions. In this dissertation, I used a variety of biochemical and biophysical methods to examine the physical properties of HMGA2 and to further investigate HMGA2's interactions with AT-rich DNA sequences. The following are three avenues perused in this study: (1) due to the asymmetrical charge distribution of HMGA2, I have developed a rapid procedure to purify HMGA2 in the milligram range. Preparation of large amounts of HMGA2 makes biophysical studies possible; (2) Since HMGA2 binds to different AT-rich sequences in the promoter regions, I used a combination of isothermal titration calorimetry (ITC) and DNA UV melting experiment to characterize interactions of HMGA2 with poly(dA-dT) 2 and poly(dA)poly(dT). My results demonstrated that (i) each HMGA2 molecule binds to 15 AT bp; (ii) HMGA2 binds to both AT DNAs with very high affinity. However, the binding reaction of HMGA2 to poly(dA-dT) 2 is enthalpy-driven and the binding reaction of HMGA2 with poly(dA)poly(dT) is entropy-driven; (iii) the binding reactions are strongly depended on salt concentrations; (3) Previous studies showed that HMGA2 may have sequence specificity. In this study, I used a PCR-based SELEX procedure to examine the DNA binding specificity of HMGA2. Two consensus sequences for HMGA2 have been identified: 5'-ATATTCGCGAWWATT-3' and 5'-ATATTGCGCAWWATT-3', where W represents A or T. These consensus sequences have a unique feature: the first five base pairs are AT-rich, the middle four to five base pairs are GC-rich, and the last five to six base pairs are AT-rich. All three segments are critical for high affinity binding. Replacing either one of the AT-rich sequences to a non-AT-rich sequence causes at least 100-fold decrease in the binding affinity. Intriguingly, if the GC-segment is substituted by an AT-rich segment, the binding affinity of HMGA2 is reduced approximately 5-fold. Identification of the consensus sequences for HMGA2 represents an important step towards finding its binding sites within the genome.

Race/Ethnicity-, Gender- and Age-Specific Differences in Micronutrient Intakes of US Adults with and without Diabetes

Race/ethnicity-, gender- and age-specific differences in dietary micronutrient intakes of US adults ≥ 21 years were assessed from National Health and Nutrition Examination Survey, 2007–2008. The participants included Black non-Hispanics, Mexican-American and White non-Hispanics who signed an informed consent form for the interview and who completed the in-person 24-h recall. Micronutrient intakes were based on the Institute of Medicines' classifications of recommended dietary allowances specific for age and gender. Likelihood of many micronutrient insufficiencies was associated with being female, over 65 years, having diabetes and minority status. Younger and female adults had a greater likelihood of iron insufficiency than male and older adults. These findings demonstrate the importance of considering the intersection of age, gender and race in setting policies for micronutrient deficiency screening, particularly in young female adults and minorities.

Gender Differences in Medical Advice and Health Behavior of Obese African Americans With and Without Type 2 Diabetes

This study examined gender differences in medical advice related to diet and physical activity for obese African American adults (N = 470) with and without diabetes. Data from the 2007-2008 National Health and Nutrition Examination Survey were analyzed using logistic regression analyses. Even after sociodemographic adjustments, men were less likely to report receiving medical advice as compared with women. Both men and women given dietary and physical activity advice were more likely to follow it. Men were less likely to report currently reducing fat or calories, yet men withdiabetes were 5 times more likely to state that they were reducing fat and calories as compared with women with diabetes. Gender- and disease state-specific interventions are needed comparing standard care with enhanced patient education. Moreover, these findings necessitate studies that characterize the role of the health care professional in the diagnosis and treatment of obesity and underscore patient-provider relationships.

Reimagining Reflection: Gender, Student Perception, and Reflective Writing in the Composition Classroom

The purpose of this thesis is to discover any existing correlation between gender and student perceptions of reflective writing in the composition classroom. Seventy-five students at Florida International University participated in a survey that explored their approaches to and understanding of reflective writing. In order to connect the specific results of this study to the larger context of composition theory, this thesis includes an examination of the theoretical background of gender and reflective writing. The results of the survey indicate that the only identifiable difference between male and female student responses resulted from their definitions of reflective writing. Beyond this difference, however, there were no significant variances in student perceptions of reflective writing. The response of these students at FIU indicates a shift in expected gender norms and suggests a reconsideration of what it means to be a gendered writer in the composition classroom.

Straight but not Narrow; Within-Gender Variation in the Gender-Specificity of Women's Sexual Response

Gender differences in the specificity of sexual response have been a primary focus in sexual psychophysiology research, however, within-gender variability suggests sexual orientation moderates category-specific responding among women; only heterosexual women show gender-nonspecific genital responses to sexual stimuli depicting men and women. But heterosexually-identified or “straight” women are heterogeneous in their sexual attractions and include women who are exclusively androphilic (sexually attracted to men) and women who are predominantly androphilic with concurrent gynephilia (sexually attracted to women). It is therefore unclear if gender-nonspecific responding is found in both exclusively and predominantly androphilic women. The current studies investigated within-gender variability in the gender-specificity of women’s sexual response. Two samples of women reporting concurrent andro/gynephilia viewed (Study 1, n = 29) or listened (Study 2, n = 30) to erotic stimuli varying by gender of sexual partner depicted while their genital and subjective sexual responses were assessed. Data were combined with larger datasets of predominantly gyne- and androphilic women (total N = 78 for both studies). In both studies, women reporting any degree of gynephilia, including those who self-identified as heterosexual, showed significantly greater genital response to female stimuli, similar to predominantly gynephilic women; gender-nonspecific genital response was observed for exclusively androphilic women only. Subjective sexual arousal patterns were more variable with respect to sexual attractions, likely reflecting stimulus intensity effects. Heterosexually-identified women are therefore not a homogenous group with respect to sexual responses to gender cues. Implications for within-gender variation in women’s sexual orientation and sexual responses are discussed.

Qualitative Comparative Analysis as a Tool for Concept Clarification, Typology Building, and Contextualized Comparisons in Gender and Feminist Research

Qualitative Comparative Analysis (QCA) is a method for the systematic analysis of cases. A holistic view of cases and an approach to causality emphasizing complexity are some of its core features. Over the last decades, QCA has found application in many fields of the social sciences. In spite of this, its use in feminist research has been slower, and only recently QCA has been applied to topics related to social care, the political representation of women, and reproductive politics. In spite of the comparative turn in feminist studies, researchers still privilege qualitative methods, in particular case studies, and are often skeptical of quantitative techniques (Spierings 2012). These studies show that the meaning and measurement of many gender concepts differ across countries and that the factors leading to feminist success and failure are context specific. However, case study analyses struggle to systematically account for the ways in which these forces operate in different locations.

«We need more women in managerial jobs» – Gender equality and management in the Nordic context : Deconstruction and critical perspectives

Focusing on the Nordic context, this article highlights complexities between gender equality discourse established at the societal level and discursive practice in organizations, particularly in relation to management, managing and managers. This research task is carried out by deconstructing a management text, and grounding the deconstruction in critical feminist literature. This analysis illustrates how managerial discourse is challenged and questioned by pro-egaliterian arguments in the Nordic context. However, it also demonstrates the pervasiveness of the gendered elements in managerial discourse, which relies on specific conceptions of parenthood where motherhood is constructed as problematic whereas fatherhood remains absent – and thus unproblematic. It is suggested that the ‘Nordic case’ provides a fruitful basis for similar studies in other societal contexts in Europe.

Specific Agreement Between The Universidad De Cuenca and The University Of New Mexico for the Program of Doctoral Studies

English

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Structural and chemical basis for anticancer activity of a series of 'beta'-tubulin ligands: molecular modeling and 3D QSAR studies

An important approach to cancer therapy is the design of small molecule modulators that interfere with microtubule dynamics through their specific binding to the ²-subunit of tubulin. In the present work, comparative molecular field analysis (CoMFA) studies were conducted on a series of discodermolide analogs with antimitotic properties. Significant correlation coefficients were obtained (CoMFA(i), q² =0.68, r²=0.94; CoMFA(ii), q² = 0.63, r²= 0.91), indicating the good internal and external consistency of the models generated using two independent structural alignment strategies. The models were externally validated employing a test set, and the predicted values were in good agreement with the experimental results. The final QSAR models and the 3D contour maps provided important insights into the chemical and structural basis involved in the molecular recognition process of this family of discodermolide analogs, and should be useful for the design of new specific ²-tubulin modulators with potent anticancer activity.