978 resultados para temporal sequence


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The sequence distribution studies on the acrylonitrile-methylmethacrylate copolymer of high methylmethacrylate (M) content (30%sequences is indicated by the pattern of a-methyl protons.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The interactive artwork Temporal arose from a series of art-science investigations with some of Australia’s leading flying fox ecologists. It was designed as a gently evolving meditation upon the complex, periodic processes that mark Australia’s often irregular seasonal changes. In turn these changes directly govern the migratory movements of Australia’s keystone pollinating mammals - the mega bats (Flying Foxes). Temporal further called attention to our increasing capacity to profoundly disturb these partners within Australia’s complex, life-supporting systems

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Antibodies were raised in rabbits against the bovine serum albumin conjugate of dpApT. Analysis by double diffusion in agar gel and quantitative precipitation test showed the presence of antibodies specific to the hapten in the antisera. Quantitative data on the specificity of the antibodies were obtained by studying the inhibition of the binding of 3H-dpApT to the anti-sera by various nonradioactive mono- and oligonucleotides, using a nitrocellulose membrane binding assay. The antibodies were found to be highly specific for the dinucleotide sequence dpApT. The antibodies were able to bind to synthetic oligonucleotides containing the sequence dpApT and to denatured calf thymus DNA.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

During the past decades agricultural intensification has caused dramatic population declines in a wide range of taxa related to farmland habitats, including farmland birds. In this thesis, I studied how boreal farmland landscape characteristics and agricultural land use affect the abundance and diversity of farmland birds using extensive field data collected by territory mapping of breeding farmland birds in various parts of Finland. My results show that the area and openness of agricultural areas are key determinants of farmland bird abundance and distribution. A landscape composition with enough open farmland combined with key habitats such as farmyards and wetland is likely to provide essential prerequisites for the occurrence of a rich farmland avifauna. In Finland, the majority of large areas suitable for open habitat specialists are located in southern and western parts of the country. However, the diversity of the species with an unfavourable conservation status in Europe (SPECs) had notable hotspot areas in northern and north-western agricultural areas. I found that in boreal agroecosystems farmland birds favour fields with springtime vegetative cover, especially agricultural grasslands and set-asides. Hence, in the spring cereal dominated Finnish agroecosystems it is the absence of field vegetation that may limit populations of many farmland bird species. It is likely that the decrease of crops providing vegetative cover in the spring, such as permanent grasslands, cultivated grass, and autumn-sown cereals, has greatly contributed to the declines of Finnish farmland birds. Grass crops have persistently declined in Finland as a consequence of specialization in crop production and the large-scale decline in livestock husbandry. Small-scale non-crop habitats, especially ditches and ditch margins, are also important for many bird species in the Finnish agroecosystems, but have dramatically declined during the last decades. A major problem for farmland bird conservation in Finland is the conflict between landscape structure and agricultural management. Areas with mixed and cattle farming are virtually absent from the large agricultural plains of southern and south-western Finland, where the landscape structure is more likely to be favourable for rich farmland bird assemblages. On the other hand, mixed and cattle farming is still rather frequent in northern and central parts of the country, where the landscape structure is not suitable for many farmland specialist birds requiring open landscapes. My results provide useful guidelines for farmland bird conservation, and imply that considerable attention needs to be paid to landscape factors when selecting areas for various conservational management actions, such as agri-environment schemes. Actions promoting the abundance of set-asides, grass crops, and ditches would markedly benefit Finnish farmland bird populations. Organic farming may benefit farmland birds, but it is not clear how general its beneficial effect is in boreal agroecosystems. The most urgent action aiming to preserve farmland biodiversity would be to support re-introducing and sustaining cattle farming by environmental subsidies. This would be especially beneficial in the southern parts of Finland, where the landscape characteristics and abundance of agricultural areas are most suitable for farmland birds and where cattle farming is currently rare.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Reaction of the bromoketals 3, 7a-g and 11 with tri-n-butyltin chloride and sodium cyanoborohydride in the presence of a catalytic amount of AIBN furnished the ethers 5, 8a-g and 13 via a tandem sequence comprising of a radical cyclisation reaction and tri-n-butylhalostannane and sodium cyanoborohydride mediated reductive demethoxylation of the resulting cyclic ketals.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The 3prime terminal 1255nt sequence of Physalis mottle virus (PhMV) genomic RNA has been determined from a set of overlapping cDNA clones. The open reading frame (ORF) at the 3prime terminus corresponds to the amino acid sequence of the coat protein (CP) determined earlier except for the absence of the dipeptide, Lys-Leu, at position 110-111. In addition, the sequence upstream of the CP gene contains the message coding for 178 amino acid residues of the C-terminus of the putative replicase protein (RP). The sequence downstream of the CP gene contains an untranslated region whose terminal 80 nucleotides can be folded into a characteristic tRNA-like structure. A phylogenetic tree constructed after aligning separately the sequence of the CP, the replicase protein (RP) and the tRNA-like structure determined in this study with the corresponding sequences of other tymoviruses shows that PhMV wrongly named belladonna mottle virus [BDMV(I)] is a separate tymovirus and not another strain of BDMV(E) as originally envisaged. The phylogenetic tree in all the three cases is identical showing that any subset of genomic sequence of sufficient length can be used for establishing evolutionary relationships among tymoviruses.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The incidence of human infections by the fungal pathogen Candida species has been increasing in recent years. Enolase is an essential protein in fungal metabolism. Sequence data is available for human and a number of medically important fungal species. An understanding of the structural and functional features of fungal enolases may provide the structural basis for their use as a target for the development of new anti-fungal drugs. We have obtained the sequence of the enolase of Candida krusei (C. krusei), as it is a significant medically important fungal pathogen. We have then used multiple sequence alignments with various enolase isoforms in order to identify C. krusei specific amino acid residues. The phylogenetic tree of enolases shows that the C. krusei enolase assembles on the tree with the fungal genes. Importantly, C. krusei lacks four amino acids in the active site compared to human enolase, as revealed by multiple sequence alignments. These differences in the substrate binding site may be exploited for the design of new anti-fungal drugs to selectively block this enzyme. The lack of the important amino acids in the active site also indicates that C. krusei enolase might have evolved as a member of a mechanistically diverse enolase superfamily catalying somewhat different reactions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Urban growth identification, quantification, knowledge of rate and the trends of growth would help in regional planning for better infrastructure provision in environmentally sound way. This requires analysis of spatial and temporal data, which help in quantifying the trends of growth on spatial scale. Emerging technologies such as Remote Sensing, Geographic Information System (GIS) along with Global Positioning System (GPS) help in this regard. Remote sensing aids in the collection of temporal data and GIS helps in spatial analysis. This paper focuses on the analysis of urban growth pattern in the form of either radial or linear sprawl along the Bangalore - Mysore highway. Various GIS base layers such as builtup areas along the highway, road network, village boundary etc. were generated using collateral data such as the Survey of India toposheet, etc. Further, this analysis was complemented with the computation of Shannon's entropy, which helped in identifying prevalent sprawl zone, rate of growth and in delineating potential sprawl locations. The computation Shannon's entropy helped in delineating regions with dispersed and compact growth. This study reveals that the Bangalore North and South taluks contributed mainly to the sprawl with 559% increase in built-up area over a period of 28 years and high degree of dispersion. The Mysore and Srirangapatna region showed 128% change in built-up area and a high potential for sprawl with slightly high dispersion. The degree of sprawl was found to be directly proportional to the distances from the cities.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

One of the monoclonal antibodies raised against bovine beta-lactoglobulin reacted with human serum retinol binding protein. The finding that this monoclonal antibody also reacted with the serum retinol binding proteins isolated from other animals, suggested that this epitopic conformation is conserved among these proteins. Using ELISA and various synthetic peptides of defined sequence, we show in this paper that the epitope defined by this monoclonal antibody comprises of the highly conserved core sequence of DTDY present in beta-lactoglobulin and retinol binding proteins.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

VP6, the intermediate capsid protein of the virion, specifies subgroup specificity of rotavirus, It is also the most conserved, both at nucleotide and amino acid levels, among group A rotaviruses and is the target of choice for rotavirus detection, In this study we report the sequence of the subgroup I (SGI)-specific VP6 from the serotype G2 strain IS2 isolated from a child suffering from acute diarrhoea in Bangalore ana its comparison with the published VP6 sequences. Interestingly, IS2 gene 6 shared highest homology with that from bovine UK strain and the protein contained substitutions by lysine at amino acid positions 97 and 134, In contrast, the amino acids Met and Glu/Asp at these respective positions are highly conserved in all the other group A rotaviruses sequenced so far, These observations have obvious implications for the evolution of serotype G2 and G2-like strains circulating in India, The SGI VP6, of a human rotavirus, possessing epitopes that are conformationally similar to those found in the native protein in the virion, was successfully expressed in E. coli and purified for the first time by single-step affinity chromatography.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Health information technology (IT) can have a profound effect on the temporal flow and organisation of work. Yet research into the context, meaning and significance of temporal factors remains limited, most likely because of its complexity. This study outlines the role of communications in the context of the temporal and organizational landscape of seven Australian residential aged care facilities displaying a range of information exchange practices and health IT capacity. The study used qualitative and observational methods to identify temporal factors associated with internal and external modes of communication across the facilities and to explore the use of artifacts. The study concludes with a depiction of the temporal landscape of residential aged care particularly in regards to the way that work is allocated, prioritized, sequenced and coordinated. We argue that the temporal landscape involves key context-sensitive factors that are critical to understanding the way that humans accommodate to, and deal with health technologies, and which are therefore important for the delivery of safe and effective care.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The time of the large sequencing projects has enabled unprecedented possibilities of investigating more complex aspects of living organisms. Among the high-throughput technologies based on the genomic sequences, the DNA microarrays are widely used for many purposes, including the measurement of the relative quantity of the messenger RNAs. However, the reliability of microarrays has been strongly doubted as robust analysis of the complex microarray output data has been developed only after the technology had already been spread in the community. An objective of this study consisted of increasing the performance of microarrays, and was measured by the successful validation of the results by independent techniques. To this end, emphasis has been given to the possibility of selecting candidate genes with remarkable biological significance within specific experimental design. Along with literature evidence, the re-annotation of the probes and model-based normalization algorithms were found to be beneficial when analyzing Affymetrix GeneChip data. Typically, the analysis of microarrays aims at selecting genes whose expression is significantly different in different conditions followed by grouping them in functional categories, enabling a biological interpretation of the results. Another approach investigates the global differences in the expression of functionally related groups of genes. Here, this technique has been effective in discovering patterns related to temporal changes during infection of human cells. Another aspect explored in this thesis is related to the possibility of combining independent gene expression data for creating a catalog of genes that are selectively expressed in healthy human tissues. Not all the genes present in human cells are active; some involved in basic activities (named housekeeping genes) are expressed ubiquitously. Other genes (named tissue-selective genes) provide more specific functions and they are expressed preferably in certain cell types or tissues. Defining the tissue-selective genes is also important as these genes can cause disease with phenotype in the tissues where they are expressed. The hypothesis that gene expression could be used as a measure of the relatedness of the tissues has been also proved. Microarray experiments provide long lists of candidate genes that are often difficult to interpret and prioritize. Extending the power of microarray results is possible by inferring the relationships of genes under certain conditions. Gene transcription is constantly regulated by the coordinated binding of proteins, named transcription factors, to specific portions of the its promoter sequence. In this study, the analysis of promoters from groups of candidate genes has been utilized for predicting gene networks and highlighting modules of transcription factors playing a central role in the regulation of their transcription. Specific modules have been found regulating the expression of genes selectively expressed in the hippocampus, an area of the brain having a central role in the Major Depression Disorder. Similarly, gene networks derived from microarray results have elucidated aspects of the development of the mesencephalon, another region of the brain involved in Parkinson Disease.