939 resultados para goldfish, colour-blind, motion detection, trainingsexperiments, random dot pattern
Resumo:
Different storage conditions can induce changes in the colour and carotenoid profiles and levels in some fruits. The goal of this work was to evaluate the influence of low temperature storage on the colour and carotenoid synthesis in two banana cultivars: Prata and Nanicão. For this purpose, the carotenoids from the banana pulp were determined by HPLC-DAD-MS/MS, and the colour of the banana skin was determined by a colorimeter method. Ten carotenoids were identified, of which the major carotenoids were all-trans-lutein, all-trans-α-carotene and all-trans-β-carotene in both cultivars. The effect of the low temperatures was subjected to linear regression analysis. In cv. Prata, all-trans-α-carotene and all-trans-β-carotene were significantly affected by low temperature (p<0.01), with negative estimated values (β coefficients) indicating that during cold storage conditions, the concentrations of these carotenoids tended to decrease. In cv. Nanicão, no carotenoid was significantly affected by cold storage (p>0.05). The accumulation of carotenoids in this group may be because the metabolic pathways using these carotenoids were affected by storage at low temperatures. The colour of the fruits was not negatively affected by the low temperatures (p>0.05).
Resumo:
A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Adjunctive therapeutic strategies that modulate the inflammatory mediators can play a significant role in periodontal therapy. In this double-blind, placebo-controlled study, 60 subjects diagnosed as periodontitis patients were evaluated for 28 days after periodontal treatment combined with selective cyclooxygenase-2 (COX-2) inhibitor. The experimental group received scaling and root planning (SRP) combined with the Loxoprofen antiinflammatory drug (SRP+Loxoprofen). The control group received SRP combined with placebo (SRP+placebo). Plaque index (PI), probing pocket depth (PD) and bleeding on probing (BOP) were monitored with an electronic probe at baseline and after 14 and 28 days. Both groups displayed clinical improvement in PD, PI and BOP. They also showed statistically similar values (p>0.05) of PD reduction on day 14 (0.4 mm) and on day 28 (0.6 mm). At the baseline, few deeper sites (>7 mm) from SRP+Loxoprofen group were responsible and most PD reduction was observed after 14 days (p<0.05). The percentage of remaining deep pockets (>7 mm) after 14 days in the SRP+Loxoprofen group was significantly lower (p<0.05) than in the SRP+placebo group. Loxoprofen presents potential effect as an adjunct of periodontal disease treatment, but long-term clinical trials are necessary to confirm its efficacy.
Resumo:
Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.
Resumo:
The aim of this study was to evaluate the efficacy of a 0.05% clobetasol propionate ointment administered in trays to 22 patients with desquamative gingivitis in a double-blind, crossover, placebo-controlled trial. Patients received container number 1 and were instructed to apply the ointment 3 times a day for 2 weeks, and to reduce the application to once a day in the third week. Next, the patients were then instructed to discontinue the treatment for 2 weeks, and were then given container 2, used in the same way and for the same length of time as container 1. Regarding signs, 17 patients presented some improvement, while 5 experienced worsening with clobetasol propionate. With the placebo, 14 patients presented some improvement, and 8 patients presented worsening. For symptoms, there was complete improvement in 2 patients, partial improvement in 12, no response in 7, and worsening in 1 with clobetasol propionate. With the placebo, there was partial improvement in 8 patients, no response in 12 and worsening in 2. No statistically significant difference was found between clobetasol and placebo (p>0.05). Within the period designed to treat the gingival lesions of the patients, clobetasol propionate did not significantly outperform the placebo.
Resumo:
Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.
Resumo:
To determine the presence of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil, 80 animals slaughtered in the public slaughterhouse of Patos city were used. Before slaughter, blood samples were collected by jugular venopuncture from each animal, and after slaughter, testicles, epidydimus and uterus were aseptically collected. For the serological diagnosis of B. ovis and B. abortus infections, the agar gel immunodiffusion (AGID) and Rose Bengal (RBT) tests were carried out, respectively. In addition, microbiological culture and polymerase chain reaction (PCR) were performed on testicle, epidydimus and uterus samples. Six animals (7.5%) tested positive for the presence of B. ovis antibodies and all animals tested negative for the presence of B. abortus antibodies. One AGID-positive animal tested positive at uterine swab culture. PCR was able to amplify DNA of Brucella spp. from the pool of testicle, epidydimus and uterus samples from AGID-positive animals. This is the first report of isolation and detection of B. ovis DNA by PCR in ovine from the Northeast region of Brazil.
Resumo:
The objective of the present study was to improve the detection of B. abortus by PCR in organs of aborted fetuses from infected cows, an important mechanism to find infected herds on the eradication phase of the program. So, different DNA extraction protocols were compared, focusing the PCR detection of B. abortus in clinical samples collected from aborted fetuses or calves born from cows challenged with the 2308 B. abortus strain. Therefore, two gold standard groups were built based on classical bacteriology, formed from: 32 lungs (17 positives), 26 spleens (11 positives), 23 livers (8 positives) and 22 bronchial lymph nodes (7 positives). All samples were submitted to three DNA extraction protocols, followed by the same amplification process with the primers B4 and B5. From the accumulated results for organ, the proportion of positives for the lungs was higher than the livers (p=0.04) or bronchial lymph nodes (p=0.004) and equal to the spleens (p=0.18). From the accumulated results for DNA extraction protocol, the proportion of positives for the Boom protocol was bigger than the PK (p<0.0001) and GT (p=0.0004). There was no difference between the PK and GT protocols (p=0.5). Some positive samples from the classical bacteriology were negative to the PCR and viceversa. Therefore, the best strategy for B. abortus detection in the organs of aborted fetuses or calves born from infected cows is the use, in parallel, of isolation by classical bacteriology and the PCR, with the DNA extraction performed by the Boom protocol.
Resumo:
The naturally occurring clonal diversity among field isolates of the major human malaria parasite Plasmodium vivax remained unexplored until the early 1990s, when improved molecular methods allowed the use of blood samples obtained directly from patients, without prior in vitro culture, for genotyping purposes. Here we briefly review the molecular strategies currently used to detect genetically distinct clones in patient-derived P. vivax samples, present evidence that multiple-clone P. vivax infections are commonly detected in areas with different levels of malaria transmission and discuss possible evolutionary and epidemiological consequences of the competition between genetically distinct clones in natural human infections. We suggest that, when two or more genetically distinct clones are present in the same host, intra-host competition for limited resources may select for P. vivax traits that represent major public health challenges, such as increased virulence, increased transmissibility and antimalarial drug resistance.
Resumo:
Due to the imprecise nature of biological experiments, biological data is often characterized by the presence of redundant and noisy data. This may be due to errors that occurred during data collection, such as contaminations in laboratorial samples. It is the case of gene expression data, where the equipments and tools currently used frequently produce noisy biological data. Machine Learning algorithms have been successfully used in gene expression data analysis. Although many Machine Learning algorithms can deal with noise, detecting and removing noisy instances from the training data set can help the induction of the target hypothesis. This paper evaluates the use of distance-based pre-processing techniques for noise detection in gene expression data classification problems. This evaluation analyzes the effectiveness of the techniques investigated in removing noisy data, measured by the accuracy obtained by different Machine Learning classifiers over the pre-processed data.