Germinação de Ternstroemia brasiliensis Cambess. (Pentaphylacaceae) de floresta de restinga

The main purpose of this work was to study the germination of Ternstroemia brasiliensis seeds both in laboratory and field conditions in order to contribute to understanding the regeneration ecology of the species. The seeds were dispersed with relatively high moisture content and exhibit a recalcitrant storage behaviour because of their sensitivity to dehydration and to dry storage. The germinability is relatively high and is not affected either by light or aril presence. The absence of the dormancy and the low sensitivity to far red light can enable to seeds to promptly germinate under Restinga forest canopy, not forming a soil seed bank. The constant temperatures of 25 ºC and 30 ºC were considered optimum for germination of T. brasiliensis seeds. Temperature germination parameters can be affected by light conditions. The thermal-time model can be a suitable tool for investigating the temperature dependence on the seed germination of T. brasiliensis. The germination characteristics de T. brasiliensis are typical of non pioneer species, and help to explain the distribution of the species. Germination of T. brasiliensis seeds in Restinga environment may be not limited by light and temperature; otherwise the soil moisture content can affect the seed germination.

Seed dispersal of Solanum thomasiifolium Sendtner (Solanaceae) in the Linhares Forest, Espírito Santo state, Brazil

The aim of this study was to analyse seed dispersal and establishment of Solanum thomasiifolium in an area of nativo vegetation in Espirito Santo state on the southeastern Brazilian coast. Ten species of birds, the crab-eating fox (Cerdocyon thous), and one species of lizard (Tropidurus torquatus) fed on S. thomasiifolium fruits and dispersed viable seeds in their faeces. The proportional contribution of each of these groups to seed dispersal was 77% (birds), 19% (crab-eating fox) and 4% (lizards). Ants also contributed to seed dispersal. More seeds were deposited in vegetation islands than in the surrounding open areas. Germination rates of seeds collected directly from fruit (control), bird droppings, the faeces of crab-eating foxes and lizards were, respectively, 64, 64, 53, and 80 %. Differences among these rates were all significant, except between birds and control. Lizards were important as seed carriers between nearby islands and they expelled a higher proportion of viable seeds. Birds and the crab-eating foxes did not enhance seed germination, but promoted seed dispersal over a wider area. Plant architecture, fruit productivity, fruit characteristics and the diversity of frugivores are important for the success of S. thomasiifolium in habitat colonization.

Fluidodinâmica de sementes de brócolos em leito fluizado e leito de jorro

The spouted and fluidized bed technologies are usually employed in operations of drying, coating and granulation of particles by the chemical and pharmaceutical industries. The use of these techniques in agronomy is limited to the treatment of some species of seeds. In this work, the objective was to analyse the fluid-dynamics of fluidized and spouted beds when broccoli (Brassica oleracea L. var. Italica) seeds are used and also to verify the influence on seed germination after 60 min of seed exposition to spouting or fluidization, at room temperature. The fluid-dynamics was defined by the measurements of the bed pressure drop as a function of the air flow rate for different seeds loads. The experimental conditions were based on the physical properties of the seeds and were limited by the apparatus dimensions. The cone-cylindrical bed was constructed in plexyglass to permit flow visualization. The values of the parameters: maximum pressure drop, minimum spouting flow rate and pressure drop, and stable spout pressure drop were experimentally obtained from the fluid-dynamic analysis and were compared with the values calculated by empirical equations found in the literature. The same procedure was carried out with the fluidized bed and the important parameters for this regime were the air velocity and the bed pressure drop at minimum fluidization. The analysis of seed germination indicated that no damage was caused to the seeds by the spout or fluidization processes.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Influência da luminosidade e da camada de cera epicuticular de superfícies de folhas de soja na infecção de Phakopsora pachyrhizi

A ferrugem asiática, causada pelo fungo Phakopsora pachyrhizi, apresenta-se como um dos mais graves problemas fitossanitários da cultura da soja no Brasil, principalmente por não existirem, até o presente momento, cultivares com níveis de resistência satisfatórios. Objetivou-se estudar a influência da luminosidade e da camada de cera das superfícies foliares na infecção de folhas de soja por P. pachyrhizi. A superfície adaxial ou abaxial de folíolos do primeiro trifólio de plantas da cultivar BRS 154, estádio fenológico V2, foi inoculada com suspensão de 10(5) urediniósporos/mL-1. As plantas foram mantidas por 24 horas em câmara úmida e temperatura de 23ºC, sob luz ou escuro, em delineamento fatorial. Posteriormente, permaneceram 14 dias em fotoperíodo de 12 horas, sendo em seguida avaliada a densidade de lesões e a severidade da doença. Em um segundo experimento, avaliou-se in vitro , no escuro e na luz, a porcentagem de germinação de urediniósporos e de formação de apressórios. As camadas de cera adaxial e abaxial dos folíolos foram analisadas quantitativamente (extrações com clorofórmio) e estruturalmente (microscopia eletrônica de varredura). A densidade de lesões e a severidade foram maiores quando se inoculou a superfície adaxial de plantas incubadas no escuro, sem interação significativa entre os fatores. A germinação dos esporos no escuro (40,7%) foi significativamente superior à germinação na luz (28,5%). O mesmo ocorreu para a formação de apressórios, no escuro (24,7%) e na luz (12,8%). A quantidade e a estrutura das ceras epicuticulares não apresentaram diferenças entre as duas superfícies.

Allelopathic evidence in Brachiaria decumbens and its potential to invade the Brazilian Cerrados

The aim of this study was to look for evidence of allelochemicals in B. decumbens, in parts of the plant from where they could easily be released to the environment. The germination inhibition of Phalaris canariensis, Lactuca sativa (standard species) and Melinis minutiflora, another invasive African grass, was tested using B. decumbens germinating seeds and aqueous leachates of the roots, green and senescent leaves, at 5, 10 and 20% w/v. Both the germinating seeds and the aqueous leachates of B. decumbens reduced the germination of the species tested; the effectiveness of the aqueous leachates increased according to concentration. Apparently, the competitive advantage of B. decumbens in the cerrados could be amplified via allelopathy.

Frugivory and seed dispersal of golden lion tamarin (Leontopithecus rosalia (Linnaeus, 1766)) in a forest fragment in the Atlantic Forest, Brazil

The influence of the golden lion tamarin (Leontopithecus rosalia) as a seed disperser was studied by monitoring two groups of tamarins from December 1998 to December 2000 (871.9 hours of observations) in a forest fragment in south-east Brazil. The tamarins consumed fruits of 57 species from at least 17 families. They ingested the seeds of 39 species, and 23 of these were put to germinate in the laboratory and/or in the field. L. rosalia is a legitimate seed disperser because the seeds of all species tested germinated after ingestion, albeit some in low percentages. These primates do not show a consistent effect in final seed germination, because they benefit some species while damaging others. Feces were examined for seeds that had been preyed upon or digested.

Qualidade de luz na biometria e anatomia foliar de plântulas de Cattleya loddigesii L. (Orchidaceae) micropropagadas

A qualidade de luz pode alterar a morfogênese das plantas por meio de uma série de processos mediados por receptores de luz, principalmente na região do vermelho e azul. O objetivo do presente estudo foi verificar alterações anatômicas foliares e características biométricas de Cattleya loddigesii 'Tipo', cultivadas in vitro, sob diferentes malhas coloridas com nível de radiação de 50% de sombreamento. Plântulas oriundas de autopolinização e sementes germinadas in vitro, com aproximadamente 1,0cm de comprimento e com raízes, foram inoculadas em meio WPM e submetidas a diferentes condições de incubação. Testou-se o efeito de sombrites coloridos (vermelho e azul) sobre os frascos cultivados em casa de vegetação (CV) e sala de crescimento (SC), além dos tratamentos, nos dois ambientes, sem utilização das telas coloridas. A avaliação foi efetuada 180 dias após inoculação. Com os resultados obtidos, observou-se que o ambiente de cultivo promove alterações anatômicas e biométricas em plântulas de Cattleya loddigesii 'Tipo' micropropagadas. As alterações promovidas pelo cultivo em luz natural evidenciam maior capacidade fotossintética, por meio de maior diferenciação dos tecidos clorofilianos, promovendo uma superfície foliar anatomicamente adaptada à fase de aclimatização.

Determination of Three-Dimensional Left Ventricle Motion to Analyze Ventricular Dyssyncrony in SPECT Images

A method to compute three-dimension (3D) left ventricle (LV) motion and its color coded visualization scheme for the qualitative analysis in SPECT images is proposed. It is used to investigate some aspects of Cardiac Resynchronization Therapy (CRT). The method was applied to 3D gated-SPECT images sets from normal subjects and patients with severe Idiopathic Heart Failure, before and after CRT. Color coded visualization maps representing the LV regional motion showed significant difference between patients and normal subjects. Moreover, they indicated a difference between the two groups. Numerical results of regional mean values representing the intensity and direction of movement in radial direction are presented. A difference of one order of magnitude in the intensity of the movement on patients in relation to the normal subjects was observed. Quantitative and qualitative parameters gave good indications of potential application of the technique to diagnosis and follow up of patients submitted to CRT.

A Morphological and Histological Characterization of Bisexual and Male Flower Types in Pomegranate

Pomegranate [Punica granatum (Punicaceae)] is characterized by having two types of flowers on the same tree: hermaphroditic bisexual flowers and functionally male flowers. This condition, defined as functional andromonoecy, can result in decreased yields resulting from the inability of male flowers to set fruit. Morphological and histological analyses of bisexual and male flowers were conducted using light and scanning electron microscopy (SEM) to characterize the different flower types observed in pomegranate plants and to better understand their developmental differences. Bisexual flowers had a discoid stigma covered with copious exudate, elongated stigmatic papillae, a single elongate style, and numerous stamens inserted on the inner wall of the calyx tube. Using fluorescence staining, high numbers of pollen tubes were observed growing through a central stylar canal. Ovules were numerous, elliptical, and anatropous. In contrast, male flowers had reduced female parts and exhibited shortened pistils of variable heights. Stigmatic papillae of male flowers had little exudate yet supported pollen germination. However, pollen tubes were rarely observed in styles. Ovules in male flowers were rudimentary and exhibited various stages of degeneration. Pollen from both types of flowers was of similar size, approximate to 20 mu m, and exhibited similar percent germination using in vitro germination assays. Pollen germination was strongly influenced by temperature. Maximal germination (greater than 74%) was obtained at 25 and 35 degrees C; pollen germination was significantly lower at 15 degrees C (58%) and 5 degrees C (10%).

Adjustment of Mineral Elements in the Culture Medium for the Micropropagation of Three Vriesea Bromeliads from the Brazilian Atlantic Forest: The Importance of Calcium

Many different species of Bromeliaceae are endangered and their conservation requires specific knowledge of their growth habits and propagation. In vitro culture of bromeliads is an important method for efficient clonal propagation and ill vitro seed g,germination can be used to maintain genetic variability. The present work aims to evaluate the in vitro growth and nutrient concentration in leaves of the epiphyte bromeliads Vriesea friburguensis Mez, Vriesea hieroglyphica (Carriere) E. Morren, and Vriesea unilateralis Mez, which exhibit slow rates of growth in vivo and in vitro. Initially, we compared the endogenous mineral composition of bromeliad plantlets grown in half-strength Murashige and Skoog (MS) medium and the mineral composition considered adequate in the literature. This approach suggested that calcium (Ca) is a critical nutrient and this was considered for new media formulation. Three new culture media were defined in which the main changes to half-strength MS medium were an increase in Ca, magnesium, sulfur, copper, and chloride and a decrease in iron, maintaining the nitrate: ammonium rate at approximate to 2:1. The main difference among the three new media formulated was Ca concentration, which varied from 1.5 mm in half-strength MS to 3.0, 6.0, and 12 mm in M2, M3, and M4 media, respectively. Consistently, all three species exhibited significantly higher fresh and dry weight on M4, the newly defined medium with the highest level of Ca (12 mm). Leaf nitrogen, potassium, zinc, magnesium and boron concentrations increased as Ca concentration in the medium increased from 1.5 to 12 mm.

Hormonal modulation of photomorphogenesis-controlled anthocyanin accumulation in tomato (Solanum lycopersicum L. cv Micro-Tom) hypocotyls: Physiological and genetic studies

Hormones are likely to be important factors modulating the light-dependent anthocyanin accumulation. Here we analyzed anthocyanin contents in hypocotyls of near isogenic Micro-Tom (MT) tomato lines carrying hormone and phytochrome mutations, as single and double-mutant combinations. In order to recapitulate mutant phenotype, exogenous hormone applications were also performed Anthocyanin accumulation was promoted by exogenous abscisic acid (ABA) and inhibited by gibberellin (GA), in accordance to the reduced anthocyanin contents measured in ABA-deficient (notabills) and GA-constitutive response (procera) mutants. Exogenous cytokinin also enhanced anthocyanin levels in MT hypocotyls. Although auxin-insensitive chageotropica mutant exhibited higher anthocyanin contents, pharmacological approaches employing exogenous auxin and a transport inhibitor did not support a direct role of the hormone in anthocyanin accumulation Analysis of mutants exhibiting increased ethylene production (epwastic) or reduced sensitivity (Never ripe), together with pharmacological data obtained from plants treated with the hormone, indicated a limited role for ethylene in anthocyanin contents. Phytochrome-deficiency (aurea) and hormone double-mutant combinations exhibited phenotypes suggesting additive or synergistic interactions, but not fully espistatic ones, in the control of anthocyanin levels in tomato hypocotyls. Our results indicate that phytochrome-mediated anthocyanin accumulation in tomato hypocotyls is modulated by distinct hormone classes via both shared and independent pathways. (C) 2010 Elsevier Ireland Ltd. All rights reserved

Allelopathic potential of bark and leaves of Esenbeckia leiocarpa Engl. (Rutaceae)

We investigated the inhibitory potential of aqueous extracts of bark and leaves of Esenbeckia leiocarpa Engl. on lettuce germination and early seedling growth. We compared the effects of four concentrations (100, 75, 50 and 25%) of each extract to water and polyethylene glycol (PEG 6000) solution controls for four replicates of 50 seeds tor germination and four replicates of ten seedlings for seedling growth. The inhibitory effects of E. leiocarpa extracts on the percentage of germination and on the germination speed seemed to be inure than simply an osmotic effect, except for the percentage of seeds germinated in bark extracts. When compared to water control. both bark and leaf extracts delayed germination, and leaf extracts also affected the percentage of germinated seeds. Leaf ex tracts of all concentrations strongly inhibited the development of seedlings and caused them some degree of abnormality; bark extracts also caused abnormalities and reduced seedling growth. Root development was more sensitive to the extracts than hypocotyl growth. The negative effects of leaf extracts on germination and seedling growth were more pronounced than those of bark extracts, and the overall effects of both extracts were positively correlated with extract concentrations.

Can Eucalyptus invade native forest fragments close to commercial stands?

Some Eucalyptus species are widely used as a plantation crop in tropical and subtropical regions. One reason for this is the diversity of end uses, but the main reason is the high level of wood production obtained from commercial plantings. With the advancement of biotechnology it will be possible to expand the geographical area in which eucalypts can be used as commercial plantation crops, especially in regions with current climatic restrictions. Despite the popularity of eucalypts and their increasing range, questions still exist, in both traditional planting areas and in the new regions: Can eucalypts invade areas of native vegetation, causing damage to natural ecosystems biodiversity? The objective of this study it was to assess whether eucalypts can invade native vegetation fragments in proximity to commercial stands, and what factors promote this invasive growth. Thus, three experiments were established in forest fragments located in three different regions of Brazil. Each experiment was composed of 40 plots (1 m(2) each one), 20 plots located at the border between the forest fragment and eucalypts plantation, and 20 plots in the interior of the forest fragments. In each experimental site, the plots were paired by two soil exposure conditions, 10 plots in natural conditions and 10 plots with soil exposure (no plant and no litter). During the rainy season, 2 g of eucalypts seeds were sown in each plot, including Eucalyptus grandis or a hybrid of E. urophylla x E. grandis, the most common commercial eucalypt species planted in the three region. At 15, 30, 45, 90, 180, 270 and 360 days after sowing, we assessed the number of seedlings of eucalypts and the number of seedlings of native species resulting from natural regeneration. Fifteen days after sowing, the greatest number of eucalypts seedlings (37 m(-2)) was observed in the plots with lower luminosity and exposed soil. Also, for native species, it was observed that exposed soil improved natural germination reaching the highest number of 163 seedlings per square meter. Site and soil exposure were the factors that have the greatest influence on seed germination of both eucalypt and native species. However, 270 days after sowing, eucalypt seedlings were not observed at any of the three experimental sites. The result shows the inability of eucalypts to adapt to condition outside of their natural range. However, native species demonstrated their strong capacity for natural regeneration in forest fragments under the same conditions where eucalypts were seeded. (C) 2011 Elsevier B.V. All rights reserved.

Impact of natural epizootics of the fungal pathogen Neozygites floridana (Zygomycetes: Entomophthorales) on population dynamics of Tetranychus evansi (Acari: Tetranychidae) in tomato and nightshade

The tomato red spider mite, Tetranychus evansi (Acari: Tetranychidae) was recently introduced in Africa and Europe, where there is an increasing interest in using natural enemies to control this pest on solanaceous crops. Two promising candidates for the control of T. evansi were identified in South America, the fungal pathogen, Neozygites floridana and the predatory mite Phytoseiulus longipes. In this study, population dynamics of T. evansi and its natural enemies together with the influence of environmental conditions on these organisms were evaluated during four crop cycles in the field and in a protected environment on nightshade and tomato plants with and without application of chemical pesticides. N. floridana was the only natural enemy found associated with T. evansi in the four crop cycles under protected environment but only in the last crop cycle in the field. In the treatments where the fungus appeared, reduction of mite populations was drastic. N. floridana appeared in tomato plants even when the population density of T. evansi was relatively low (less than 10 mites/3.14 cm(2) of leaf area) and even at this low population density, the fungus maintained infection rates greater than 50%. The application of pesticides directly affected the fungus by delaying epizootic initiation and contributing to lower infection rates than unsprayed treatments. Rainfalls did not have an apparent impact on mite populations. These results indicate that the pathogenic fungus, N. floridana can play a significant role in the population dynamics of T. evansi, especially under protected environment, and has the potential to control this pest in classical biological control programs. (C) 2009 Elsevier Inc. All rights reserved.