978 resultados para dangerous chemicals


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Like ants and termites some species of stingless bees (Meliponini), which are very important pollinators in the tropics, use pheromone trails to communicate the location of a food source. We present data on the communicative role of mandibular gland secretions of Meliponini that resolve a recent controversy about their importance in the laying of such trails. Volatile constituents of the mandibular glands have been erroneously thought both to elicit aggressive/defensive behaviour and to signal food source location. We studied Trigona spinipes and Scaptotrigona aff. depilis (`postica`), two sympatric species to which this hypothesis was applied. Using extracts of carefully dissected glands instead of crude cephalic extracts we analysed the substances contained in the mandibular glands of worker bees. Major components of the extracts were 2-heptanol (both species), nonanal (T. spinipes), benzaldehyde and 2-tridecanone (S. aff. depilis). The effect of mandibular gland extracts and of individual components thereof on the behaviour of worker bees near their nest and at highly profitable food sources was consistent. Independent of the amount of mandibular gland extract applied, the bees overwhelmingly reacted with defensive behaviour and were never attracted to feeders scented with mandibular gland extract or any of the synthetic chemicals tested. Both bee species are capable of using mandibular gland secretions for intra-and interspecific communication of defence and aggression and share 2-heptanol as a major pheromone compound. While confirming the role of the mandibular glands in nest defence, our experiments provide strong evidence against their role in food source signalling.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fear-relevant stimuli, such as snakes, spiders and heights, preferentially capture attention as compared to nonfear-relevant stimuli. This is said to reflect an encapsulated mechanism whereby attention is captured by the simple perceptual features of stimuli that have evolutionary significance. Research, using pictures of snakes and spiders, has found some support for this account; however, participants may have had prior fear of snakes and spiders that influenced results. The current research compared responses of snake and spider experts who had little fear of snakes and spiders, and control participants across a series of affective priming and visual search tasks. Experts discriminated between dangerous and nondangerous snakes and spiders, and expert responses to pictures of nondangerous snakes and spiders differed from those of control participants. The current results dispute that stimulus fear relevance is based purely on perceptual features, and provides support for the role of learning and experience.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Objective To measure the residues of spinosad and chlorhexidine in the tissues of sheep after treatment of blowfly strike. Procedure Fourteen sheep with natural myiasis and 12 with artificial infestations of Lucilia cuprina larvae had the wool removed over their infestations and were treated with an aerosol wound dressing containing spinosad and chlorhexidine. Sheep were killed up to 14 days after treatment and residues of the chemicals measured in tissues. Results Chlorhexidine was not detected in any tissue. Residues of spinosad were highest in fat, lowest in muscle and intermediate in liver and kidney. The highest residue detected was 0.2 mg/kg spinosad in perirenal fat 7 days after generous treatment of a sheep with a large fly strike. Residues of spinosad in fat peaked 3 to 7 days after treatment and 1 to 3 days after treatment in liver and kidney. Conclusion These studies present a realistic worst-case in struck sheep and at the highest dose studied, equivalent to 5.8 mg spinosad per kg body weight, the maximum residue detected of 0.2 mg/kg in peri-renal fat was 20% of the Australian maximum residue limit. Muscle, liver and kidney residues of spinosad were also below the Australian maximum residue limits at all times.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The midbrain rectum structures, dorsal periaqueductal gray (dPAG) and inferior colliculus (IC), are involved in the organization of fear and anxiety states during the exposure to dangerous stimuli. Since opiate withdrawal is associated with increased anxiety in both humans and animals, this study aimed to investigate the possible sensitization of the neural substrates of fear in the midbrain tectum and its influence on the morphine withdrawal-induced anxiety. For the production of drug withdrawal, rats received morphine injections (10 mg/kg; s.c.) twice daily during 10 days. Forty-eight hours after the interruption of the chronic treatment, independent groups were probed in the elevated plus-maze and open-field tests. Additional groups of animals were implanted with a bipolar electrode into the dPAG OF the IC and submitted to the electrical stimulation of these structures for the determination of the freezing and escape thresholds after 48 h of withdrawal. Our results showed that the morphine withdrawal promoted clear-cut levels of anxiety without the somatic signs of opiate withdrawal. Moreover, morphine-withdrawn rats had an increase in the reactivity to the electrical stimulation of the dPAG and the IC. These findings suggest that the increased anxiety induced by morphine withdrawal is associated with the sensitization of the neural substrates of fear in the dPAG and the IC. So, the present results give support to the hypothesis that withdrawal from chronic treatment with morphine leads to fear states possibly engendered by activation of the dPAG and IC, regardless of the production of somatic symptoms. (C) 2008 Elsevier B.V. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Withdrawal from morphine leads to the appearance of extreme anxiety accompanied of several physical disturbances, most of them linked to the activation of brainstem regions such as the locus coeruleus, ventral tegmental area, hypothalamic nuclei and periaqueductal grey (PAG). As anxiety remains one of the main components of morphine withdrawal the present study aimed to evaluating the influence of the dorsal aspects of the PAG on the production of this state, since this structure is well-known to be involved in defensive behaviour elicited by anxiety-evoking stimuli. Different groups of animals were submitted to 10 days of i.p. morphine injections, challenged 2 h after with an i.p. injection of naloxone (0.1 mg/kg), and submitted to the plus-maze, open-field and light-dark transition tests. The effects of morphine withdrawal on anxiety-induced Fos immunolabelling were evaluated in four animals that passed by the light-dark transition test randomly chosen for Fos-protein analysis. Besides the PAG, Fos neural expression was conducted in other brain regions involved in the expression of anxiety-related behaviours. Our results showed that morphine withdrawn rats presented enhanced anxiety accompanied of few somatic symptoms. Increased Fos immunolabelling was noted in brain regions well-known to modulate these states as the prelimbic cortex, nucleus accumbens, amygdala and paraventricular hypothalamus. Increased Fos labelling was also observed in the ventral and dorsal aspects of the PAG, a region involved in anxiety-related processes suggesting that this region could be a common neural substrate enlisted during anxiety evoked by dangerous stimuli as well as those elicited by opiate withdrawal. (c) 2008 Elsevier Inc. All rights reserved,

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Foraging adults of phytophagous insects are attracted by host-plant volatiles and supposedly repelled by volatiles from non-host plants. In behavioural control of pest insects, chemicals derived from non-host plants applied to crops are expected to repel searching adults and thereby reduce egg laying. How experience by searching adults of non-host volatiles affects their subsequent searching and oviposition behaviour has been rarely tested. In laboratory experiments, we examined the effect of experience of a non-host-plant extract on the oviposition behaviour of the diamondback moth (DBM), Plutella xylostella, a specialist herbivore of cruciferous plants. Naive ovipositing DBM females were repelled by an extract of dried leaves of Chrysanthemum morifolium, a non-host plant of DBM, but experienced females were not repelled. Instead they were attracted by host plants treated with the non-host-plant extract and laid a higher proportion of eggs on treated than on untreated host plants. Such behavioural changes induced by experience could lead to host-plant range expansion in phytophagous insects and play an important role in determining outcome for pest management of some behavioural manipulation methods.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Allergic contact dermatitis is the consequence of an immune reaction mediated by T cells against low molecular weight chemicals known as haptens. It is a common condition that occurs in all races and age groups and affects the quality of life of those who present it. The immunological mechanism of this disease has been reviewed in recent decades with significant advance in its understanding. The metabolism and pathway of the haptens as well as the activation and mechanism of action of the cells responsible for both the immune reaction and its completion are discussed in this article.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

PHWAT is a new model that couples a geochemical reaction model (PHREEQC-2) with a density-dependent groundwater flow and solute transport model (SEAWAT) using the split-operator approach. PHWAT was developed to simulate multi-component reactive transport in variable density groundwater flow. Fluid density in PHWAT depends not on only the concentration of a single species as in SEAWAT, but also the concentrations of other dissolved chemicals that can be subject to reactive processes. Simulation results of PHWAT and PHREEQC-2 were compared in their predictions of effluent concentration from a column experiment. Both models produced identical results, showing that PHWAT has correctly coupled the sub-packages. PHWAT was then applied to the simulation of a tank experiment in which seawater intrusion was accompanied by cation exchange. The density dependence of the intrusion and the snow-plough effect in the breakthrough curves were reflected in the model simulations, which were in good agreement with the measured breakthrough data. Comparison simulations that, in turn, excluded density effects and reactions allowed us to quantify the marked effect of ignoring these processes. Next, we explored numerical issues involved in the practical application of PHWAT using the example of a dense plume flowing into a tank containing fresh water. It was shown that PHWAT could model physically unstable flow and that numerical instabilities were suppressed. Physical instability developed in the model in accordance with the increase of the modified Rayleigh number for density-dependent flow, in agreement with previous research. (c) 2004 Elsevier Ltd. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Dherte PM, Negrao MPG, Mori Neto S, Holzhacker R, Shimada V, Taberner P, Carmona MJC - Smart Alerts: Development of a Software to Optimize Data Monitoring. Background and objectives: Monitoring is useful for vital follow-ups and prevention, diagnosis, and treatment of several events in anesthesia. Although alarms can be useful in monitoring they can cause dangerous user`s desensitization. The objective of this study was to describe the development of specific software to integrate intraoperative monitoring parameters generating ""smart alerts"" that can help decision making, besides indicating possible diagnosis and treatment. Methods: A system that allowed flexibility in the definition of alerts, combining individual alarms of the parameters monitored to generate a more elaborated alert system was designed. After investigating a set of smart alerts, considered relevant in the surgical environment, a prototype was designed and evaluated, and additional suggestions were implemented in the final product. To verify the occurrence of smart alerts, the system underwent testing with data previously obtained during intraoperative monitoring of 64 patients. The system allows continuous analysis of monitored parameters, verifying the occurrence of smart alerts defined in the user interface. Results: With this system a potential 92% reduction in alarms was observed. We observed that in most situations that did not generate alerts individual alarms did not represent risk to the patient. Conclusions: Implementation of software can allow integration of the data monitored and generate information, such as possible diagnosis or interventions. An expressive potential reduction in the amount of alarms during surgery was observed. Information displayed by the system can be oftentimes more useful than analysis of isolated parameters.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The acute Porphyrias are examples of toxico-genetic diseases and diseases genetically acquired, which show an idiosyncratic reaction to certain chemicals and drugs. Porphyrics are at risk of developing an acute attack if exposed to various precipitating factors of which drugs are the most common factor. This paper presents lists of drugs complied into those hazardous for patients with acute porphyria and those thought to be safe.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Objective: The Traffic Engineering Company of the City of Sao Paulo (Brazil) observed a decrease in productivity, and an increase in sick leave, accidents and psychological distress among their parking inspection agents. To document this situation, qualitative research was undertaken to obtain an in-depth comprehension of work activity. Participants: Workers, managers and health and safety professionals contributed to the documentation of the problem and to the proposal of possible solutions. Methods: Ergonomic work analysis focusing on real work activity, as well as interviews with individual or groups of stakeholders, were conducted. Results: This research revealed that political-economic factors gradually contributed to: 1) an increasing work load; 2) growing fatigue throughout the day, increasing the workers` vulnerability to incidents and accidents and their tendency to react inappropriately to violence experienced on the street; and 3) excessive individual responsibility to manage dangerous situations. Conclusions: Recommendations to ameliorate the situation are proposed. These suggestions are discussed in terms of feasibility given the impact of macro social factors upon micro work activity, and the associated potential expansion of the ergonomist`s role.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Objectives: To evaluate the genotoxic risk to hairdressers exposed daily to chemical substances such as hair dyes, waving and straightening preparations and manicurists` products by the Comet assay test (single-cell gel electrophoresis). Methods: The Comet assay was performed on blood samples from 69 female hairdressers (36.4 +/- 10.7 years old) currently employed in 21 different beauty institutes in Sao Paulo, Brazil, and on 55 female control blood donors (32.6 +/- 10.0 years old) from the Sao Paulo University Clinical Hospital blood bank. All the control subjects had occupations other than hairdresser. Comet assays were performed by evaluating 100 blood lymphocytes per individual and graded by visual score according to comet tail length. Results: The hairdressers showed a higher frequency of DNA damage revealed by Comet Score (159.8 +/- 71) when compared to the control group (125.4 +/- 64.1), and the difference was statistically significant by the Student`s t-test (P = 0.005). Multiple regression analysis showed that in addition to the hairdressers` profession, tobacco use contributed to the higher frequency of cells with comets (P < 0.05). Conclusions: The observed DNA damage could be associated with the hairdressers` occupational environment, where different chemicals are chronically manipulated and inhaled. Considering that this profession in many countries, including Brazil, is not officially regulated, more attention should focus on these professionals not only by legislative bodies but also by multidisciplinary teams able to develop and implement risk prevention and control strategies for chemical, physical and biological agents to which hairdressers are exposed.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

According to the Brazilian Federal Medical Association, transsexualism is recognized as a gender identity disorder if a long-term diagnostic therapeutic process has demonstrated that the transposition of gender roles is irreversible, and if only hormonal and surgical procedures are appropriate to relieve the stress associated with the gender identity. Although such treatment will only be initiated with caution and after a long phase of intense diagnostic screening, the differentiation between pure identity disorders and transsexual feelings secondary to an ongoing psychopathologic process, such as schizophrenia, can be arduous for many health professionals. To report a case of a female patient with schizophrenia and transsexualism and the risks of a potential diagnostic confusion. A 19-year-old black woman, with an 8-year history of undifferentiated schizophrenia and intense gender dysphoria, was referred for sex reassignment surgery evaluation in the Ambulatory for the Treatment of Sexual Disorders of the ABC Medical School. After a more adequate antipsychotic treatment, her masculine behavior has persisted, but her desire to change her own genital organs has decreased. A better acceptance of the multiplicity of possible genders should neither contribute to inadequate interpretations of the signs and symptoms of our patients nor facilitate dangerous clinical or surgical recommendations. Baltieri DA, and De Andrade AG. Schizophrenia Modifying the expression of gender identity disorder. J Sex Med **;**:**-**.