Correlation Between Cephalometric Data And Severity Of Sleep Apnea.

Obstructive sleep apnea syndrome has a high prevalence among adults. Cephalometric variables can be a valuable method for evaluating patients with this syndrome. To correlate cephalometric data with the apnea-hypopnea sleep index. We performed a retrospective and cross-sectional study that analyzed the cephalometric data of patients followed in the Sleep Disorders Outpatient Clinic of the Discipline of Otorhinolaryngology of a university hospital, from June 2007 to May 2012. Ninety-six patients were included, 45 men, and 51 women, with a mean age of 50.3 years. A total of 11 patients had snoring, 20 had mild apnea, 26 had moderate apnea, and 39 had severe apnea. The distance from the hyoid bone to the mandibular plane was the only variable that showed a statistically significant correlation with the apnea-hypopnea index. Cephalometric variables are useful tools for the understanding of obstructive sleep apnea syndrome. The distance from the hyoid bone to the mandibular plane showed a statistically significant correlation with the apnea-hypopnea index.

Screening The Life Cycle Of Schistosoma Mansoni Using High-resolution Mass Spectrometry.

Schistosomiasis is a common tropical disease caused by Schistosoma species Schistosomiasis' pathogenesis is known to vary according to the worms' strain. Moreover, high parasitical virulence is directly related to eggs release and granulomatous inflammation in the host's organs. This virulence might be influenced by different classes of molecules, such as lipids. Therefore, better understanding of the metabolic profile of these organisms is necessary, especially for an increased potential of unraveling strain virulence mechanisms and resistance to existing treatments. In this report, direct-infusion electrospray high-resolution mass spectrometry (ESI(+)-HRMS) along with the lipidomic platform were employed to rapidly characterize and differentiate two Brazilian S. mansoni strains (BH and SE) in three stages of their life cycle: eggs, miracidia and cercariae, with samples from experimental animals (Swiss/SPF mice). Furthermore, urine samples of the infected and uninfected mice were analyzed to assess the possibility of direct diagnosis. All samples were differentiated using multivariate data analysis, PCA, which helped electing markers from distinct lipid classes; phospholipids, diacylglycerols and triacylglycerols, for example, clearly presented different intensities in some stages and strains, as well as in urine samples. This indicates that biochemical characterization of S. mansoni may help narrowing-down the investigation of new therapeutic targets according to strain composition and aggressiveness of disease. Interestingly, lipid profile of infected mice urine varies when compared to control samples, indicating that direct diagnosis of schistosomiasis from urine may be feasible.

New Microsatellite Markers For Wild And Commercial Species Of Passiflora (passifloraceae) And Cross-amplification.

• We developed the first microsatellites for Passiflora setacea and characterized new sets of markers for P. edulis and P. cincinnata, enabling further genetic diversity studies to support the conservation and breeding of passion fruit species. • We developed 69 microsatellite markers and, in conjunction with assessments of cross-amplification using primers available from the literature, present 43 new polymorphic microsatellite loci for three species of Passiflora. The mean number of alleles per locus was 3.1, and the mean values of the expected and observed levels of heterozygosity were 0.406 and 0.322, respectively. • These microsatellite markers will be valuable tools for investigating the genetic diversity and population structure of wild and commercial species of passion fruit (Passiflora spp.) and may be useful for developing conservation and improvement strategies by contributing to the understanding of the mating system and hybridization within the genus.

Evolution Of The Deaths Registry System In Brazil: Associations With Changes In The Mortality Profile, Under-registration Of Death Counts, And Ill-defined Causes Of Death.

This paper examines the spatial pattern of ill-defined causes of death across Brazilian regions, and its relationship with the evolution of completeness of the deaths registry and changes in the mortality age profile. We make use of the Brazilian Health Informatics Department mortality database and population censuses from 1980 to 2010. We applied demographic methods to evaluate the quality of mortality data for 137 small areas and correct for under-registration of death counts when necessary. The second part of the analysis uses linear regression models to investigate the relationship between, on the one hand, changes in death counts coverage and age profile of mortality, and on the other, changes in the reporting of ill-defined causes of death. The completeness of death counts coverage increases from about 80% in 1980-1991 to over 95% in 2000-2010 at the same time the percentage of ill-defined causes of deaths reduced about 53% in the country. The analysis suggests that the government's efforts to improve data quality are proving successful, and they will allow for a better understanding of the dynamics of health and the mortality transition.

An Update On The Pharmacogenetics Of Treating Hypertension.

Hypertension is a leading cause of cardiovascular mortality, but only one third of patients achieve blood pressure goals despite antihypertensive therapy. Genetic polymorphisms may partially account for the interindividual variability and abnormal response to antihypertensive drugs. Candidate gene and genome-wide approaches have identified common genetic variants associated with response to antihypertensive drugs. However, there is no currently available pharmacogenetic test to guide hypertension treatment in clinical practice. In this review, we aimed to summarize the recent findings on pharmacogenetics of the most commonly used antihypertensive drugs in clinical practice, including diuretics, angiotensin-converting enzyme inhibitors and angiotensin II receptor blockers, beta-blockers and calcium channel blockers. Notably, only a small percentage of the genetic variability on response to antihypertensive drugs has been explained, and the vast majority of the genetic variants associated with antihypertensives efficacy and toxicity remains to be identified. Despite some genetic variants with evidence of association with the variable response related to these most commonly used antihypertensive drug classes, further replication is needed to confirm these associations in different populations. Further studies on epigenetics and regulatory pathways involved in the responsiveness to antihypertensive drugs might provide a deeper understanding of the physiology of hypertension, which may favor the identification of new targets for hypertension treatment and genetic predictors of antihypertensive response.Journal of Human Hypertension advance online publication, 28 August 2014; doi:10.1038/jhh.2014.76.

High-resolution Transcript Profiling Of The Atypical Biotrophic Interaction Between Theobroma Cacao And The Fungal Pathogen Moniliophthora Perniciosa.

Witches' broom disease (WBD), caused by the hemibiotrophic fungus Moniliophthora perniciosa, is one of the most devastating diseases of Theobroma cacao, the chocolate tree. In contrast to other hemibiotrophic interactions, the WBD biotrophic stage lasts for months and is responsible for the most distinctive symptoms of the disease, which comprise drastic morphological changes in the infected shoots. Here, we used the dual RNA-seq approach to simultaneously assess the transcriptomes of cacao and M. perniciosa during their peculiar biotrophic interaction. Infection with M. perniciosa triggers massive metabolic reprogramming in the diseased tissues. Although apparently vigorous, the infected shoots are energetically expensive structures characterized by the induction of ineffective defense responses and by a clear carbon deprivation signature. Remarkably, the infection culminates in the establishment of a senescence process in the host, which signals the end of the WBD biotrophic stage. We analyzed the pathogen's transcriptome in unprecedented detail and thereby characterized the fungal nutritional and infection strategies during WBD and identified putative virulence effectors. Interestingly, M. perniciosa biotrophic mycelia develop as long-term parasites that orchestrate changes in plant metabolism to increase the availability of soluble nutrients before plant death. Collectively, our results provide unique insight into an intriguing tropical disease and advance our understanding of the development of (hemi)biotrophic plant-pathogen interactions.

[meanings Of The Sickening Process For Patients With Systemic Lupus Erythematosus: A Review Of The Literature.]

Systemic lupus erythematosus is an autoimmune disease that causes many psychological repercussions that have been studied through qualitative research. These are considered relevant, since they reveal the amplitude experienced by patients. Given this importance, this study aims to map the qualitative production in this theme, derived from studies of experiences of adult patients of both genders and that had used as a tool a semi-structured interview and/or field observations, and had made use of a sampling by a saturation criterion to determine the number of participants in each study. The survey was conducted in Pubmed, Lilacs, Psycinfo e Cochrane databases, searching productions in English and Portuguese idioms published between January 2005 and June 2012. The 19 revised papers that have dealt with patients in the acute phase of the disease showed themes that were categorized into eight topics that contemplated the experienced process at various stages, from the onset of the disease, extending through the knowledge of the diagnosis and the understanding of the manifestations of the disease, drug treatment and general care, evolution and prognosis. The collected papers also point to the difficulty of understanding, of the patients, on what consists the remission phase, revealing also that this is a clinical stage underexplored by psychological studies.

Metacommunity Versus Biogeography: A Case Study Of Two Groups Of Neotropical Vegetation-dwelling Arthropods.

Biogeography and metacommunity ecology provide two different perspectives on species diversity. Both are spatial in nature but their spatial scales do not necessarily match. With recent boom of metacommunity studies, we see an increasing need for clear discrimination of spatial scales relevant for both perspectives. This discrimination is a necessary prerequisite for improved understanding of ecological phenomena across scales. Here we provide a case study to illustrate some spatial scale-dependent concepts in recent metacommunity studies and identify potential pitfalls. We presented here the diversity patterns of Neotropical lepidopterans and spiders viewed both from metacommunity and biogeographical perspectives. Specifically, we investigated how the relative importance of niche- and dispersal-based processes for community assembly change at two spatial scales: metacommunity scale, i.e. within a locality, and biogeographical scale, i.e. among localities widely scattered along a macroclimatic gradient. As expected, niche-based processes dominated the community assembly at metacommunity scale, while dispersal-based processes played a major role at biogeographical scale for both taxonomical groups. However, we also observed small but significant spatial effects at metacommunity scale and environmental effects at biogeographical scale. We also observed differences in diversity patterns between the two taxonomical groups corresponding to differences in their dispersal modes. Our results thus support the idea of continuity of processes interactively shaping diversity patterns across scales and emphasize the necessity of integration of metacommunity and biogeographical perspectives.

Engineered Nanoparticles And Organic Matter: A Review Of The State-of-the-art.

Growth in the development and production of engineered nanoparticles (ENPs) in recent years has increased the potential for interactions of these nanomaterials with aquatic and terrestrial environments. Carefully designed studies are therefore required in order to understand the fate, transport, stability, and toxicity of nanoparticles. Natural organic matter (NOM), such as the humic substances found in water, sediment, and soil, is one of the substances capable of interacting with ENPs. This review presents the findings of studies of the interaction of ENPs and NOM, and the possible effects on nanoparticle stability and the toxicity of these materials in the environment. In addition, ENPs and NOM are utilized for many different purposes, including the removal of metals and organic compounds from effluents, and the development of new electronic sensors and other devices for the detection of active substances. Discussion is therefore provided of some of the ways in which NOM can be used in the production of nanoparticles. Although there has been an increase in the number of studies in this area, further progress is needed to improve understanding of the dynamic interactions between ENPs and NOM.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Association of insulin resistance and GLP-2 secretion in obesity: a pilot study

OBJECTIVE: The objective of this pilot study was to determine whether glugagon-like peptide 2 (GLP-2) secretion relates to insulin sensitivity (IS) in obese subjects. SUBJECTS AND METHODS: Twenty four obese subjects [body mass index (BMI) 40.0 ± 3.0 kg/m² (mean ± standard deviation)] were included, nine of which were male, age 43 ± 8 years. Twelve subjects had type 2 diabetes, all treated with oral anti-diabetic agents only. The subjects were submitted to standard meal tolerance test (MTT) for dosage of the curves: glucose, insulin, and GLP-2. Insulin sensitivity was measured by HOMA-IR, and OGIS was derived from the MTT. Spearman linear correlations and partial correlations were obtained. RESULTS: There was an inverse relationship between the GLP-2 secretion and IS: HOMA-IR correlated with GLP-2 AUC (R = 0.504; p = 0.012), and OGIS correlated with GLP-2 incremental AUC (R = -0.54; p = 0.054). The correlation persisted after controlling for BMI. CONCLUSION: We found an association of GLP-2 secretion and insulin resistance (IR). The understanding of the underlying mechanisms may provide future directions in the pharmacological manipulation of incretins, and in the treatment of obesity and related metabolic disorders.

Trajetórias de vida : lembranças, caminhos e constituições dos saberes docentes de professores de Educação Física = Paths and trajectories of life : memories, paths and establishment of teaching knowledge of Physical Education Professors

Universidade Estadual de Campinas . Faculdade de Educação Física

Validation of an experimental polyurethane model for biomechanical studies on implant-supported prosthesis: compression tests

OBJECTIVES: The complexity and heterogeneity of human bone, as well as ethical issues, most always hinder the performance of clinical trials. Thus, in vitro studies become an important source of information for the understanding of biomechanical events on implant-supported prostheses, although study results cannot be considered reliable unless validation studies are conducted. The purpose of this work was to validate an artificial experimental model based on its modulus of elasticity, to simulate the performance of human bone in vivo in biomechanical studies of implant-supported prostheses. MATERIAL AND METHODS: In this study, fast-curing polyurethane (F16 polyurethane, Axson) was used to build 40 specimens that were divided into five groups. The following reagent ratios (part A/part B) were used: Group A (0.5/1.0), Group B (0.8/1.0), Group C (1.0/1.0), Group D (1.2/1.0), and Group E (1.5/1.0). A universal testing machine (Kratos model K - 2000 MP) was used to measure modulus of elasticity values by compression. RESULTS: Mean modulus of elasticity values were: Group A - 389.72 MPa, Group B - 529.19 MPa, Group C - 571.11 MPa, Group D - 470.35 MPa, Group E - 437.36 MPa. CONCLUSION: The best mechanical characteristics and modulus of elasticity value comparable to that of human trabecular bone were obtained when A/B ratio was 1:1.

Two-dimensional gel electrophoretic protein profile analysis during seed development of Ocotea catharinensis: a recalcitrant seed species

The aim of the present work was to characterize changes in the protein profile throughout seed development in O. catharinensis, a recalcitrant species, by two-dimensional gel electrophoresis. Protein extraction was undertaken by using a thiourea/urea buffer, followed by a precipitation step with 10% TCA. Comparative analysis during seed development showed that a large number of proteins were exclusively detected in each developmental stage. The cotyledonary stage, which represents the transition phase between embryogenesis and the beginning of metabolism related to maturation, presents the highest number of stage-specific spots. Protein identification, through MS/MS analysis, resulted in the identification of proteins mainly related to oxidative metabolism and storage synthesis. These findings contribute to a better understanding of protein metabolism during seed development in recalcitrant seeds, besides providing information on established markers that could be useful in defining and improving somatic embryogenesis protocols, besides monitoring the development of somatic embryos in this species.

Effects of human trampling on a rocky shore fauna on the Sao Paulo coast, southeastern Brazil

Increased tourist activity in coastal regions demands management strategies to reduce impacts on rocky shores. The highly populated coastal areas in southeastern Brazil are an example of degradation caused by development of industry and tourism. Among different shore impacts, trampling has been intensively studied, and may represent a significant source of stress for intertidal fauna. A randomised blocks design was applied to experimentally study the effects of two different trampling intensities on richness, diversity, density and biomass of the rocky shore fauna of Obuseiro beach, Guarujá, southeastern Brazil. Blocks were distributed in two portions of the intertidal zone, dominated respectively by Chthamalus bisinuatus (Cirripedia) and Isognomon bicolor (Bivalvia). Blocks were trampled over three months, simulating the vacation period in Brazil and were monitored for the following nine months. Results indicate that Chthamalus bisinuatus is vulnerable to trampling impacts. Richness, diversity and turn-over index tended to be higher in trampled plots four months after trampling ceased. In general, results agree with previous trampling studies, suggesting that even low intensities of trampling may cause some impact on intertidal communities. Management strategies should include isolation of sensitive areas, construction of boardwalks, visitor education and monitoring programmes. In Brazil, additional data obtained from experimental studies are necessary in order to achieve a better understanding of trampling impacts on rocky shore communities.