968 resultados para Tandem queue


Relevância:

10.00% 10.00%

Publicador:

Resumo:

in Escherichia coli, the DnaG primase is the RNA polymerase that synthesizes RNA primers at replication forks. It is composed of three domains, a small N-terminal zinc-binding domain, a larger central domain responsible for RNA synthesis, and a C-terminal domain comprising residues 434-581 [DnaG(434-581)] that interact with the hexameric DnaB helicase. Presumably because of this interaction, it had not been possible previously to express the C-terminal domain in a stably transformed E coli strain. This problem was overcome by expression of DnaG(434-581) under control of tandem bacteriophage gimel-promoters, and the protein was purified in yields of 4-6 mg/L of culture and studied by NMR. A TOCSY spectrum of a 2 mM solution of the protein at pH 7.0, indicated that its structured core comprises residues 444-579. This was consistent with sequence conservation among most-closely related primases. Linewidths in a NOESY spectrum of a 0.5 mM sample in 10 mM phosphate, pH 6.05, 0.1 M NaCl, recorded at 36 degreesC, indicated the protein to be monomeric. Crystals of selenomethionine-substituted DnaG(434-581) obtained by the hanging-drop vapor-diffusion method were body-centered tetragonal, space group I4(1)22, with unit cell parameters a = b 142.2 Angstrom, c = 192.1 Angstrom, and diffracted beyond 2.7 Angstrom resolution with synchrotron radiation. (C) 2003 Elsevier Inc. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The high speciFIcity of alpha-conotoxins for different neuronal nicotinic acetylcholine receptors makes them important probes for dissecting receptor subtype selectivity. New sequences continue to expand the diversity and utility of the pool of available alpha-conotoxins. Their identification and characterization depend on a suite of techniques with increasing emphasis on mass spectrometry and microscale chromatography, which have benefited from recent advances in resolution and capability. Rigorous physicochemical analysis together with synthetic peptide chemistry is a prerequisite for detailed conformational analysis and to provide sufficient quantities of alpha-conotoxins for activity assessment and structure-activity relationship studies.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Drosophila antonietae is a cactophilic species that is found in the mesophilic forest of the Parana`-Paraguay river basin and in the dunes of the South Atlantic coast of Brazil. Although the genetic structure of the Parana`-Paraguay river basin populations has already been established, the relationship between these populations and those on the Atlantic coast is controversial. In this study, we compared 33 repetitive units of pBuM-2 satellite DNA isolated from individuals from 8 populations of D. antonietae in these geographic regions, including some populations found within a contact zone with the closely related D. serido. The pBuM-2 sequences showed low interpopulational variability. This result was interpreted as a consequence of both gene flow among the populations and unequal crossing over promoting homogenization of the tandem arrays. The results presented here, together with those of previous studies, highlight the use of pBuM-2 for solving taxonomic conflicts within the D. buzzatii species cluster.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

We investigated the production of a hepatotoxic, cyclic heptapeptide, microcystin, by a filamentous branched cyanobacterium belonging to the order Stigonematales, genus Fischerella. The freshwater Fischerella sp. strain CENA161 was isolated from spring water in a small concrete dam in Piracicaba, Sao Paulo State, Brazil, and identified by combining a morphological description with 16S rRNA gene sequencing and phylogenetic analysis. Microcystin (MCYST) analysis performed using an ELISA assay on cultured cells gave positive results. High performance liquid chromatography-mass spectrometry (HPLC-MS) analysis detected 33.6 mu g MCYST-LR per gram dry weight of cyanobacterial cells. Microcystin profile revealed by quadrupole time-of-flight tandem mass spectrometry (Q-TOF-MS/MS) analysis confirmed the production of MCYST-LR. Furthermore, genomic DNA was analyzed by PCR for sequences similar to the ketosynthase (KS) domain of the type I polyketide synthase gene, which is involved in microcystin biosynthesis. This revealed the presence of a KS nucleotide fragment similar to the mcyD and ndaD genes of the microcystin and nodularin synthetase complexes. Phylogenetic analysis grouped the Fischerella KS sequence together with mcyD sequences of the three known microcystin synthetase operon (Microcystis, Planktothrix and Anabaena) and ndaD of the nodularin synthetase operon, with 100% bootstrap support. Our findings demonstrate that Fischerella sp. CENA161 produces MYCST-LR and for the first time identify a nucleotide sequence putatively involved in microcystin synthesis in this genus. (C) 2009 Elsevier Ltd. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A sensitive and reproducible method by microextraction packed sorbent and liquid chromatography with UV detection (MEPS/LC-UV) is described for the determination of new generation antidepressants (sertraline, mirtazapine, fluoxetine, citalopram and paroxetine) in human plasma samples. The MEPS variables, such as sample volume, pH, number of extraction cycles (draw-eject), and desorption conditions (solvent and solvent volume of elution) influenced the MEPS/LC efficiency significantly. Important factors in the optimization of MEPS efficiency, as well as washing steps and carryover effect are discussed. The analyses were carried out using small sample volumes (400 mu L.), and in a short time period (3 min for the entire sample preparation step). The MEPS/LC-UV method was shown to be linear at concentrations ranging from the limit of quantification (LOQ) to 1000 ng mL(-1). The LOQ values ranged from 10 to 25 ng mL(-1). The inter-day precision of the method presented coefficient of the variation ranging from 1.3% to 8.7%. On the basis of analytical validation, it is shown that the MEPS/LC-UV methodology is adequate for antidepressant analysis, from therapeutic to toxic levels. In order to evaluate the proposed method for clinical use, the MEPS/LC-UV method was applied to analysis of plasma samples from elderly depressed patients. (C) 2010 Elsevier B.V. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Synthetic metalloporphyrins, in the presence of monooxygen donors, are known to mimetize various reactions of cytochrome P450 enzymes systems in the oxidation of drugs and natural products. The oxidation of piperine and piplartine by iodosylbenzene using iron(III) and manganese(III) porphyrins yielded mono- and dihydroxylated products, respectively. Piplartine showed to be a more reactive substrate towards the catalysts tested. The structures of the oxidation products were proposed based on electrospray ionization tandem mass spectrometry.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The pathways involved in the maintenance of human embryonic stem (hES) cells remain largely unknown, although some signaling pathways have been identified in mouse embryonic stem (mES) cells. Fibroblast feeder layers are used to maintain the undifferentiated growth of hES cells and an examination of the conditioned media (CM) of human neonatal fibroblasts (HNFs) could provide insights into the maintenance of hES cells. The neonatal foreskin fibroblast line (HNF02) used in this study was shown to have a normal 2n = 46, XY chromosomal complement and to support the undifferentiated growth of the Embryonic Stem Cell International Pte. Ltd.-hES3 cell line. The CM of HNF02 was examined using two-dimensional liquid chromatography-tandem mass spectrometry (2-D LCMS) and two-dimensional electrophoresis (2-DE) followed by matrix-assisted laser desorption/ionization-time of flight tandem mass spectrometry (2-DE/MALDI). A total of 102 proteins were identified, 19 by 2-DE/MALDI, 53 by 2-D LCMS and 30 by both techniques. These proteins were classified into 15 functional groups. Proteins identified in the extracellular matrix and differentiation and growth factor functional categories were considered most likely to be involved in the maintenance of hES cell growth, differentiation and pluripotency as these groups contained proteins involved in a variety of events including cell adhesion, cell proliferation and inhibition of cell proliferation, Writ signaling and inhibition of bone morphogenetic proteins.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A tandem ionization chamber was developed for quality control programs of X-ray equipment used in conventional radiography and mammography. A methodology for the use of the tandem chamber in the constancy check of diagnostic X-ray beam qualities was established. The application at a medical X-ray imaging facility of this established methodology is presented. The use of the tandem chamber in the constancy check of diagnostic X-ray beam qualities is a useful method to control the performance of the X-ray equipment. (c) 2008 Elsevier Ltd. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A polymorphism of the dopamine transporter gene (DAT1, 10-repeat) is associated with attention-deficit hyperactivity disorder (ADHD) and has been linked to an enhanced response to methylphenidate (MPH). One aspect of the attention deficit in ADHD includes a subtle inattention to left space, resembling that seen after right cerebral hemisphere damage. Since left-sided inattention in ADHD may resolve when treated with MPH, we asked whether left-sided inattention in ADHD was related to DAT1 genotype and the therapeutic efficacy of MPH. A total of 43 ADHD children and their parents were genotyped for the DAT1 30 variable number of tandem repeats polymorphism. The children performed the Landmark Test, a well-validated measure yielding a spatial attentional asymmetry index ( leftward to rightward attentional bias). Parents rated their child's response to MPH retrospectively using a three-point scale ( no, mediocre or very good response). Additionally, parents used a symptom checklist to rate behavior while on and off medication. A within-family control design determined whether asymmetry indices predicted biased transmission of 10-repeat parental DAT1 alleles and/or response to MPH. It was found that left-sided inattention predicted transmission of the 10-repeat allele from parents to probands and was associated with the severity of ADHD symptomatology. Children rated as achieving a very good response to MPH displayed left-sided inattention, while those rated as achieving a poorer response did not. Our results suggest a subgroup of children with ADHD for whom the 10-repeat DAT1 allele is associated with left-sided inattention. MPH may be most efficacious in this group because it ameliorates a DAT1-mediated hypodopaminergic state.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

P>Background Congenital adrenal hyperplasia caused by classic 21-hydroxylase deficiency (21OHD) is an autosomal recessive disorder with a high prevalence of asymptomatic heterozygote carriers (HTZ) in the general population, making case detection desirable by routine methodology. HTZ for classic and nonclassic (NC) forms have basal and ACTH-stimulated values of 17-hydroxyprogesterone (17OHP) that fail to discriminate them from the general population. 21-Deoxycortisol (21DF), an 11-hydroxylated derivative of 17OHP, is an alternative approach to identify 21OHD HTZ. Objective To determine the discriminating value of basal and ACTH-stimulated serum levels of 21DF in comparison with 17OHP in a population of HTZ for 21OHD (n = 60), as well as in NC patients (n = 16) and in genotypically normal control subjects (CS, n = 30), using fourth generation tandem mass spectrometry after HPLC separation (LC-MS/MS). Results Basal 21DF levels were not different between HTZ and CS, but stimulated values were increased in the former and virtually nonresponsive in CS. Only 17 center dot 7% of the ACTH-stimulated 21DF levels overlapped with CS, when compared to 46 center dot 8% for 17OHP. For 100% specificity, the sensitivities achieved for ACTH-stimulated 21DF, 17OHP and the quotient [(21DF + 17OHP)/F] were 82 center dot 3%, 53 center dot 2% and 87%, using cut-offs of 40, 300 ng/dl and 46 (unitless), respectively. Similar to 17OHP, ACTH-stimulated 21DF levels did not overlap between HTZ and NC patients. A positive and highly significant correlation (r = 0 center dot 846; P < 0 center dot 001) was observed between 21DF and 17OHP pairs of values from NC and HTZ. Conclusion This study confirms the superiority of ACTH-stimulated 21DF, when compared to 17OHP, both measured by LC-MS/MS, in identifying carriers for 21OHD. Serum 21DF is a useful tool in genetic counselling to screen carriers among relatives in families with affected subjects, giving support to molecular results.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The study reported here is a classical bottom-up proteomic approach where proteins from wasp venom were extracted and separated by 2-DE; the individual protein spots were proteolytically digested and subsequently identified by using tandem mass spectrometry and database query with the protein search engine MASCOT. Eighty-four venom proteins belonging to 12 different molecular functions were identified. These proteins were classified into three groups; the first is constituted of typical venom proteins: antigens-5, hyaluronidases, phospholipases, heat shock proteins, metalloproteinases, metalloproteinase-desintegrin like proteins, serine proteinases, proteinase inhibitors, vascular endothelial growth factor-related protein, arginine kinases, Sol i-II and -II like proteins, alpha-glucosidase, and superoxide dismutases. The second contained proteins structurally related to the muscles that involves the venom reservoir. The third group, associated with the housekeeping of cells from venom glands, was composed of enzymes, membrane proteins of different types, and transcriptional factors. The composition of P. paulista venom permits us to hypothesize about a general envenoming mechanism based on five actions: (i) diffusion of venom through the tissues and to the blood, (ii) tissue, (iii) hemolysis, (iv) inflammation, and (v) allergy-played by antigen-5, PLA1, hyaluronidase, HSP 60, HSP 90, and arginine kinases.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The SH3 domains of src and other nonreceptor tyrosine kinases have been shown to associate with the motif PXXP, where P and X stand for proline and an unspecified amino acid, but a motif that binds to the SH3 domain of myosin has thus far not been characterized. We previously showed that the SH3 domain of Acanthamoeba myosin-IC interacts with the protein Acan125. We now report that the Acan125 protein sequence contains two tandem consensus PXXP motifs near the C terminus. To test for binding, we expressed a polypeptide, AD3p, which includes 344 residues of native C-terminal sequence and a mutant polypeptide, AD3 Delta 977-994p, which lacks the sequence RPKPVPPPRGAKPAPPPR containing both PXXP motifs. The SH3 domain of Acanthamoeba myosin-IC bound AD3p and not AD3 Delta 977-994p, showing that the PXXP motifs are required for SH3 binding. The sequence of Acan125 is related overall to a protein of unknown function coded by Caenorhabditis elegans gene K07G5.1. The K07G5.1 gene product contains a proline-rich segment similar to the SH3 binding motif found in Acan125. The aligned sequences show considerable conservation of leucines and other hydrophobic residues, including the spacing of these residues, which matches a motif for leucine-rich repeats (LRRs). LRR domains have been demonstrated to be sites for ligand binding. Having an LRR domain and an SH3-binding domain, Acan125 and the C. elegans homologue define a novel family of bifunctional binding proteins.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Aims: To evaluate the IL1RN polymorphism as a possible marker for Rheumatic Fever (RF) susceptibility or disease severity. Methods: The genotypes of 84 RF patients (Jones criteria) and 84 normal race-matched controls were determined through the analysis of the number of 86-bp tandem repeats in the second intron of IL1RN. The DNA was extracted from peripheral-blood leukocytes and amplified with specific primers. Clinical manifestations of RF were obtained through a standardized questionnaire and an extensive chart review. Carditis was defined as new onset cardiac murmur that was perceived by a trained physician with corresponding valvae regurgitation or stenosis on echocardiogram. Carditis was classified as severe in the presence of congestive heart failure or upon the indication for cardiac surgery. The statistical association among the genotypes, RF and its clinical variations was determined. Results: The presence of allele I and the genotype A1/A1 were found less frequently among patients with severe carditis when compared to patients without this manifestation (OR = 0.11, p = 0.031; OR = 0.092, p = 0.017). Neither allele I nor allele 2 were associated with the presence of RF (p = 0.188 and p = 0.106), overall carditis (p = 0.578 and p = 0.767), polyarthritis (p = 0.343 and p = 0.313) and chorea (p = 0.654 and p = 0.633). Conclusion: In the Brazilian population, the polymorphism of the IL-1ra gene is a relevant factor for rheumatic heart disease severity. (C) 2009 Elsevier Ltd. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The photodegradation of irinotecan (CPT-11), the semisynthetic derivative of the antitumor alkaloid 20(S)-camptothecin, has been investigated. The drug was exposed to laboratory light for up to 5 days in 0.9% saline solution (pH 8.5). Five significant photodegradation products were observed and a high-performance liquid chromatography (HPLC) assay was employed to isolate them from CPT-11 using gradient conditions. The structures were elucidated by nuclear magnetic resonance spectroscopy and tandem mass spectrometry and shown to be the result of extensive modifications of the lactone ring of CPT-11. Three of the compounds were found to belong to the mappicine group of alkaloids. In addition, the effect of light on the stability of CPT-11 in aqueous solutions and biological fluids was also assessed, Potassium phosphate buffers (0.05 M, pH 5.0-8.2) and saline, plasma, urine, and bile solutions containing 20 mu M CPT-11 were equilibrated in the dark for 24 h before being exposed to laboratory light for up to 171 h at ambient temperature. Four of the five identified photodegradation products were observed and quantitated by isocratic HPLC, using a different detection mode (fluorescence) than the one used for gradient elution, In general, CPT-11 was found to be unstable under neutral and alkaline conditions for all solutions investigated, with the exception of bile. We conclude that CPT-11 is photolabile and that care should be taken to protect samples, particularly those intended for the isolation and identification of novel metabolites of CPT-11.