978 resultados para Somatosensory response detection
Resumo:
Neks are serine-threonine kinases that are similar to NIMA, a protein found in Aspergillus nidulans which is essential for cell division. In humans there are eleven Neks which are involved in different biological functions besides the cell cycle control. Nek4 is one of the largest members of the Nek family and has been related to the primary cilia formation and in DNA damage response. However, its substrates and interaction partners are still unknown. In an attempt to better understand the role of Nek4, we performed an interactomics study to find new biological processes in which Nek4 is involved. We also described a novel Nek4 isoform which lacks a region of 46 amino acids derived from an insertion of an Alu sequence and showed the interactomics profile of these two Nek4 proteins. Isoform 1 and isoform 2 of Nek4 were expressed in human cells and after an immunoprecipitation followed by mass spectrometry, 474 interacting proteins were identified for isoform 1 and 149 for isoform 2 of Nek4. About 68% of isoform 2 potential interactors (102 proteins) are common between the two Nek4 isoforms. Our results reinforce Nek4 involvement in the DNA damage response, cilia maintenance and microtubule stabilization, and raise the possibility of new functional contexts, including apoptosis signaling, stress response, translation, protein quality control and, most intriguingly, RNA splicing. We show for the first time an unexpected difference between both Nek4 isoforms in RNA splicing control. Among the interacting partners, we found important proteins such as ANT3, Whirlin, PCNA, 14-3-3ε, SRSF1, SRSF2, SRPK1 and hNRNPs proteins. This study provides new insights into Nek4 functions, identifying new interaction partners and further suggests an interesting difference between isoform 1 and isoform 2 of this kinase. Nek4 isoform 1 may have similar roles compared to other Neks and these roles are not all preserved in isoform 2. Besides, in some processes, both isoforms showed opposite effects, indicating a possible fine controlled regulation.
Resumo:
A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
The aim of this study was to investigate the histological and histomorphometrical bone response to three Biosilicates with different crystal phases comparing them to Bioglass®45S5 implants used as control. Ceramic glass Biosilicate and Bioglass®45S5 implants were bilaterally inserted in rabbit femurs and harvested after 8 and 12 weeks. Histological examination did not revealed persistent inflammation or foreign body reaction at implantation sites. Bone and a layer of soft tissue were observed in close contact with the implant surfaces in the medullary canal. The connective tissue presented few elongated cells and collagen fibers located parallel to implant surface. Cortical portion after 8 weeks was the only area that demonstrated significant difference between all tested materials, with Biosilicate 1F and Biosilicate 2F presenting higher bone formation than Bioglass®45S5 and Biosilicate® vitreo (p=0.02). All other areas and periods were statistically non-significant (p>0.05). In conclusion, all tested materials were considered biocompatible, demonstrating surface bone formation and a satisfactory behavior at biological environment.
Resumo:
This study evaluated the response of the subcutaneous connective tissue of BALB/c mice to root filling materials indicated for primary teeth: zinc oxide/eugenol cement (ZOE), Calen paste thickened with zinc oxide (Calen/ZO) and Sealapex sealer. The mice (n=102) received polyethylene tube implants with the materials, thereby forming 11 groups, as follows: I, II, III: Calen/ZO for 7, 21 and 63 days, respectively; IV, V, VI: Sealapex for 7, 21 and 63 days, respectively; VII, VIII, IX: ZOE for 7, 21 and 63 days, respectively; X and XI: empty tube for 7 and 21 days, respectively. The biopsied tissues were submitted to histological analysis (descriptive analysis and semi-quantitative analysis using a scoring system for collagen fiber formation, tissue thickness and inflammatory infiltrate). A quantitative analysis was performed by measuring the area and thickness of the granulomatous reactionary tissue (GRT). Data were analyzed by Kruskal-Wallis, ANOVA and Tukey's post-hoc tests (?=0.05). There was no significant difference (p>0.05) among the materials with respect to collagen fiber formation or GRT thickness. However, Calen/ZO produced the least severe inflammatory infiltrate (p<0.05). The area of the GRT was significantly smaller (p<0.05) for Calen/ZO and Sealapex. In conclusion, Calen/ZO presented the best tissue reaction, followed by Sealapex and ZOE.
Resumo:
This study was evaluated the response of subcutaneous connective tissue of isogenic mice to calcium hydroxide-based pastes with chlorhexidine digluconate (CHX). Seventy isogenic male BALB/c mice aged 6-8 weeks and weighing 15-20 g were randomly assigned to 8 groups. The animals received polyethylene tube implants as follows: Groups I, II, and III (n=10) - Calen® paste mixed with 0.4% CHX (experimental paste; Calen/CHX) for 7, 21, and 63 days, respectively; Groups IV, V, and VI (n=10) - UltraCal™ paste mixed with 2% CHX (experimental paste supplied by Ultradent Products Inc.; Ultracal/CHX) for 7, 21, and 63 days, respectively; and Groups VII and VIII (n=5): empty tube for 7 and 21 days, respectively. At the end of the experimental periods, the implants were removed together with the surrounding tissues (skin and subcutaneous connective tissue). The biopsied tissues were subjected to routine processing for histological analysis. Using a descriptive analysis and a four-point (0-3) scoring system, the following criteria were considered for qualitative and quantitative analysis of the tissue around the implanted materials: collagen fiber formation, tissue thickness and inflammatory infiltrate. A quantitative analysis was performed by measuring the thickness (µm), area (µm²) and perimeter (µm) of the reactionary granulomatous tissue formed at the tube ends. Data were analyzed statistically by the Kruskal-Wallis test and Dunn's post-test (α=0.05). Calen/CHX showed biocompatibility with the subcutaneous and reactionary tissues, with areas of discrete fibrosis and normal conjunctive fibrous tissue, though without statistically significant difference (p>0.05) from the control groups. In Groups I to III, there was a predominance of score 1, while in Groups IV to VI scores 2 and 3 predominated for all analyzed parameters. UltraCal/CHX, on the other hand, induced the formation of an inflammatory infiltrate and abundant exudate, suggesting a persistent residual aggression from the material, even 63 days after implant placement. In conclusion, the Calen paste mixed with 0.4% CHX allowed an adequate tissue response, whereas the UltraCal paste mixed with 2% CHX showed unsatisfactory results.
Resumo:
This study evaluated bone response to a Ca- and P- enriched titanium (Ti) surface treated by a multiphase anodic spark deposition coating (BSP-AK). Two mongrel dogs received bilateral implantation of 3 Ti cylinders (4.1 x 12 mm) in the humerus, being either BSP-AK treated or untreated (machined - control). At 8 weeks postimplantation, bone fragments containing the implants were harvested and processed for histologic and histomorphometric analyses. Bone formation was observed in cortical area and towards the medullary canal associated to approximately 1/3 of implant extension. In most cases, in the medullary area, collagen fiber bundles were detected adjacent and oriented parallel to Ti surfaces. Such connective tissue formation exhibited focal areas of mineralized matrix lined by active osteoblasts. The mean percentages of bone-to-implant contact were 2.3 (0.0-7.2 range) for BSP-AK and 0.4 (0.0-1.3 range) for control. Although the Mann-Whitney test did not detect statistically significant differences between groups, these results indicate a trend of BSP-AK treated surfaces to support contact osteogenesis in an experimental model that produces low bone-to-implant contact values.
Resumo:
PURPOSE: This study evaluated the inflammatory reaction caused by the implantation of iodoform and calcium hydroxide in the back of rats. These drugs may be used as intracanal dressings to eliminate residual bacteria of the root canal system. METHODS: Twenty albinic rats (Rattus norvegicus, var Wistar) were divided into four groups: control group 1 (CG1) had normal skin; control group 2 (CG2) had wounded tissue without drugs; in groups 3 and 4, iodoform (IG) and calcium hydroxide (CHG) were inserted into the wounds, respectively. After 3, 5 and 11 days, slices of the implanted areas were macroscopically and microscopically observed regarding to their qualitative and quantitative aspects. RESULTS: In the macroscopical analysis, the CHG showed a large area of necrosis and swelling, which progressively decreased; in the IG the presence of iodoform surrounded by normal tissue was observed. The qualitative and quantitative histological analysis showed that IG promoted a shorter delay in the inflammatory response than the CHG. CONCLUSION: The inflammatory reaction for iodoform had a peak period five days after the drug insertion. By comparison, calcium hydroxide showed a very large area of necrosis that could only be partially eliminated after eleven days.
Resumo:
Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.
Resumo:
Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.
Resumo:
Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.
Resumo:
To determine the presence of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil, 80 animals slaughtered in the public slaughterhouse of Patos city were used. Before slaughter, blood samples were collected by jugular venopuncture from each animal, and after slaughter, testicles, epidydimus and uterus were aseptically collected. For the serological diagnosis of B. ovis and B. abortus infections, the agar gel immunodiffusion (AGID) and Rose Bengal (RBT) tests were carried out, respectively. In addition, microbiological culture and polymerase chain reaction (PCR) were performed on testicle, epidydimus and uterus samples. Six animals (7.5%) tested positive for the presence of B. ovis antibodies and all animals tested negative for the presence of B. abortus antibodies. One AGID-positive animal tested positive at uterine swab culture. PCR was able to amplify DNA of Brucella spp. from the pool of testicle, epidydimus and uterus samples from AGID-positive animals. This is the first report of isolation and detection of B. ovis DNA by PCR in ovine from the Northeast region of Brazil.
Resumo:
The objective of the present study was to improve the detection of B. abortus by PCR in organs of aborted fetuses from infected cows, an important mechanism to find infected herds on the eradication phase of the program. So, different DNA extraction protocols were compared, focusing the PCR detection of B. abortus in clinical samples collected from aborted fetuses or calves born from cows challenged with the 2308 B. abortus strain. Therefore, two gold standard groups were built based on classical bacteriology, formed from: 32 lungs (17 positives), 26 spleens (11 positives), 23 livers (8 positives) and 22 bronchial lymph nodes (7 positives). All samples were submitted to three DNA extraction protocols, followed by the same amplification process with the primers B4 and B5. From the accumulated results for organ, the proportion of positives for the lungs was higher than the livers (p=0.04) or bronchial lymph nodes (p=0.004) and equal to the spleens (p=0.18). From the accumulated results for DNA extraction protocol, the proportion of positives for the Boom protocol was bigger than the PK (p<0.0001) and GT (p=0.0004). There was no difference between the PK and GT protocols (p=0.5). Some positive samples from the classical bacteriology were negative to the PCR and viceversa. Therefore, the best strategy for B. abortus detection in the organs of aborted fetuses or calves born from infected cows is the use, in parallel, of isolation by classical bacteriology and the PCR, with the DNA extraction performed by the Boom protocol.
Resumo:
OBJECTIVE: To compare the emotional response and level of anxiety of psychopathic murderers, non-psychopathic murderers, and nonpsychopathic non-criminals. METHOD: 110 male individuals aged over 18 years were divided into three groups: psychopathic murderers (n = 38); non-psychopathic murderers (n = 37) serving sentences for murder convictions in Maximum Security Prisons in the State of Sao Paulo; and non-criminal, non-psychopathic individuals (n = 35) according to the Psychopathy Checklist-Revised. The emotional response of subjects was assessed by heart rate variation and anxiety level (State-Trait Anxiety Inventory) after viewing standardized pictures depicting pleasant, unpleasant and neutral content from the International Affective Picture System. RESULTS: Psychopathic murderers presented lower anxiety levels and smaller heart rate variations when exposed to pleasant and unpleasant stimuli than nonpsychopathic murderers or non-psychopathic non-criminals. The results also demonstrated that the higher the score for factor 1 on the Psychopathy Checklist-Revised, the lower the heart rate variation and anxiety level. CONCLUSION: The results suggest that psychopathic murderers do not present variation in emotional response to different visual stimuli. Although the non-psychopathic murderers had committed the same type of crime as the psychopathic murderers, the former tended to respond with a higher level of anxiety and heart rate variation.
Resumo:
The naturally occurring clonal diversity among field isolates of the major human malaria parasite Plasmodium vivax remained unexplored until the early 1990s, when improved molecular methods allowed the use of blood samples obtained directly from patients, without prior in vitro culture, for genotyping purposes. Here we briefly review the molecular strategies currently used to detect genetically distinct clones in patient-derived P. vivax samples, present evidence that multiple-clone P. vivax infections are commonly detected in areas with different levels of malaria transmission and discuss possible evolutionary and epidemiological consequences of the competition between genetically distinct clones in natural human infections. We suggest that, when two or more genetically distinct clones are present in the same host, intra-host competition for limited resources may select for P. vivax traits that represent major public health challenges, such as increased virulence, increased transmissibility and antimalarial drug resistance.