959 resultados para Skilled Hours
Resumo:
Nanorap is a new nanotechnological formulation for topical anesthesia composed of lidocaine (2.5%) and prilocaine (2.5%). The present study evaluated the pharmacokinetics (PK) of Nanorap. For the determination of lidocaine and prilocaine in human plasma a new method using high-performance liquid-chromatography coupled to tandem mass spectrometry was developed. Nanorap pharmacodynamic (PD) and its physical proprieties were also evaluated. Nanorap was administered by topical application of 2g to healthy volunteers and blood samples were collected for the PK analysis. The drugs were extracted from plasma by liquid-liquid extraction with ether/hexane (80/20, v/v). The chromatography separation was performed on a Genesis C18 analytical column 4 µm (100 x 2.1 mm i.d.) with a mobile phase of methanol/acetonitrile/water (40/30/30, for lidocaine, and 50/30/20, for prilocaine, v/v/v) + 2 mM of ammonium acetate and ropivacaine as internal standard. The drugs were quantified using a mass spectrometer with an electrospray source in the ESI positive mode (ES+) configured for multiple reaction monitoring. The PD of Nanorap was evaluated with the use of a visual analogue scale. Nanorap was characterized by cryofracture. The chromatography run time was 5.5 min for lidocaine and 3.3 min for prilocaine and the lower limit of quantification was 0.05 ng/mL for both drugs. Mean Cmax was 6.62 and 1.72 ng/mL for lidocaine and prilocaine, respectively. Median Tmax was 6.5 hours for both drugs. Nanocapsules had a mean size of 88nm and mean drug association of 92.5% and 89% for lidocaine and prilocaine, respectively. The PD study showed that Nanorap has a sufficient analgesic effect (>30% reduction in pain) after 10 minutes of application. A new simple, selective and sensitive method for determination of lidocaine and prilocaine in human plasma was developed. Nanorap generated safe plasma levels of the drugs and satisfactory analgesic effect.
Resumo:
The aim of this study was to analyze the reasons for missed appointments in dental Family Health Units (FHU) and implement strategies to reduce same through action research. This is a study conducted in 12 FHUs in Piracicaba in the State of São Paulo from January, 1 to December, 31 2010. The sample was composed of 385 users of these health units who were interviewed over the phone and asked about the reasons for missing dental appointments, as well as 12 dentists and 12 nurses. Two workshops were staged with professionals: the first to assess the data collected in interviews and develop strategy, and the second for evaluation after 4 months. The primary cause for missed appointments was the opening hours of the units coinciding with the work schedule of the users. Among the strategies suggested were lectures on oral health, ongoing education in team meetings, training of Community Health Agents, participation in therapeutic groups and partnerships between Oral Health Teams and the social infrastructure of the community. The adoption of the single medical record was the strategy proposed by professionals. The strategies implemented led to a 66.6% reduction in missed appointments by the units and the motivating nature of the workshops elicited critical reflection to redirect health practices.
Resumo:
Phenytoin is an effective antiepileptic drug, although, it can be associated with many side effects, including dyskinesia. OBJECTIVE: To describe the clinical characteristics of phenytoin induced dyskinesia. METHODS: We investigated the occurrence of involuntary movements in patients followed at our adult and pediatric epilepsy clinics during the period of one year. RESULTS: Three patients presented with phenytoin-induced dyskinesia: one adult with axial and orofacial dyskinesia, and two children with choreoathetosis. They did not have other signs of phenytoin intoxication and had complete recovery after phenytoin withdrawal. CONCLUSION: Phenytoin induced dyskinesia may occur during either chronic or initial treatment and with normal serum phenytoin levels. However, it occurs most often in patients on polytherapy, usually after increasing dosage and with toxic serum levels. Other signs of phenytoin intoxication may be present in these patients, but often the dyskinesia is the only side effect, which may delay the diagnosis and treatment. The clinical characteristics of the involuntary movements vary and may be focal or generalized, most often characterized by choreoathetosis and dyskinesias. These may last for hours, days or even years, but frequently disappear completely after phenytoin withdrawal.
Resumo:
Video-polygraphic-EEG studies were performed in the first 24 life-hours of 26 healthy full-term newborns without perinatal injuries. The neurological examination and cranial ultrasonography were normal. The newborns were divided into two groups: one, with full-term appropriate - birth weight 11 newborns (control group ) and the other with full-term low-birth weight 15 newborns. Thirteen newborns of the second group had video-polygraphic-EEG study abnormalities. The most frequent abnormalities were found in 11 cases, as far as sleep architecture is concerned. Also, when compared with the control group, 8 cases of an excessive amount of startles and 2 cases of low behavior activities were found. The results demonstrate the usefulness of video-polygraphic-EEG study in the full-term newborns with intra-uterine growth retard. This examination was sensitive to detect behavior, sleep architecture and EEG standard differences in the low birth-weight newborns as to the control group.
Resumo:
High-speed counter-current chromatography (HSCCC) is a major tool for the fast separation of natural products from plants. It was used for the preparative isolation of the flavonoid monoglucosides present in the aerial parts of the Davilla elliptica St. Hill. (Dilleniaceae). This species is used in Brazilian folk medicine for the treatment of gastric disorders. The optimum solvent system used was composed of a mixture of ethyl acetate-n-propanol-water (140:8:80, v/v/v) and led to a successful separation of quercetin-3-O-alpha-L-rhamnopyranoside and myricetin-3-O-alpha-L-rhamnopyranoside in approximately 3.0 hours with purity higher than 95%. Identification was performed by ¹H NMR, 13C NMR and HPLC-UV-DAD analyses.
Resumo:
Losses of horticulture product in Brazil are significant and among the main causes are the use of inappropriate boxes and the absence of a cold chain. A project for boxes is proposed, based on computer simulations, optimization and experimental validation, trying to minimize the amount of wood associated with structural and ergonomic aspects and the effective area of the openings. Three box prototypes were designed and built using straight laths with different configurations and areas of openings (54% and 36%). The cooling efficiency of Tommy Atkins mango (Mangifera Indica L.) was evaluated by determining the cooling time for fruit packed in the wood models and packed in the commercially used cardboard boxes, submitted to cooling in a forced-air system, at a temperature of 6ºC and average relative humidity of 85.4±2.1%. The Finite Element Method was applied, for the dimensioning and structural optimization of the model with the best behavior in relation to cooling. All wooden boxes with fruit underwent vibration testing for two hours (20 Hz). There was no significant difference in average cooling time in the wooden boxes (36.08±1.44 min); however, the difference was significant in comparison to the cardboard boxes (82.63±29.64 min). In the model chosen for structural optimization (36% effective area of openings and two side laths), the reduction in total volume of material was 60% and 83% in the cross section of the columns. There was no indication of mechanical damage in the fruit after undergoing the vibration test. Computer simulations and structural study may be used as a support tool for developing projects for boxes, with geometric, ergonomic and thermal criteria.
Resumo:
The objective of this study was to quantify the effect of plonk on compressive behavior and mechanical attributes such as consistency, optimum moisture for compaction and maximum density of a Red-Yellow Latosol (Oxisol) to evaluate the effect of plonk and compaction state in splashed particles, from Lavras (MG) region. The plonk was obtained from an artisanal sugarcane brandy alembic. Undisturbed and disturbed soil samples were collected at 0 to 3 cm and 60 to 63 cm depths. Disturbed soil samples were used for soil characterization, determination of consistence limits and Normal Proctor essay after material incubation with plonk. Undisturbed soil samples were saturated with plonk or distilled water (control) during 48 hours for testing the compressibility and resistance to splash by using simulated rainfall. The plonk altered the consistence limits of studied layers. For the 0-3 cm layer, the plonk reduced the friable range, and for the 60-63 cm layer the effect was in the opposite direction. For both layers, the plonk increased Dmax and decreased Uoptimum. Regardless of the plonk treatment, both layers presented the same load support capacity. The compaction degree of samples influenced the splash erosion. The increase of the applied pressure over the samples resulted in increase of splash material quantity. At the 60-63 cm layer, the plonk treatment reduced the splash material quantity by increasing the applied pressure, mainly when the samples were at field capacity.
Resumo:
Culture supernatant of Staphylococcus aureus 722 in 3% triptone plus 1% yeast extract was used for EEA purification, proceeding comparison between dye ligand Red A affinity chromatography and classic chromatography. The capture of SEA with Amberlite CG-50 allowed rapid enterotoxin concentration from the culture supernatant. However, the ratio of 15 mg of the resin to a total of 150 mg of the toxin satured the resin, giving only 10 to 30% of SEA recuperation from the supernatant. The elution of concentrated material throught the Red A column resulted in a recovery of 60,87% of the toxin, and required 76 hours, indicating advantage on classic chromatography. Ion exchange column plus gel filtration recovered only 6,5 % of the SEA, and required 114 hours to conclude the procedure. The eletrophoresis of purified SEA indicated high grade of toxin obtained from Red A column, with 90 % of purity, compared to 60 % of classic column.
Resumo:
Quality traits of boneless rib cut (L. dorsi muscle) from Nelore young bulls. To study the meat quality traits of Nelore breed young bulls, and the effect of age (690-780 days) on them, 113 animals were slaughtered after 109 days of intensive feeding with 20% concentrate and 80% roughage. All the carcasses were graded at the slaughter floor by the Federal Inspection and chilled for 24 hours (Tinitial=5°C, Tfinal=2°C). Fifty one half carcasses (right side), type B - B R A S I L `s grading system - from animals of 23 to 26 months were boned and separated into commercial cuts. Two steaks (2.5cm thick) were removed from each boneless rib cut (m. L. dorsi), vacuum packaged and aged for 7 days (0-2°C). The pH varied from 5.44 to 5.83 and only two samples had pH ³ 5.70. The L* (brightness) average value was 34.85. The water and fat content were 75.65% and 1.71%, respectively. The average WB shear force was 6.70kg, and it was not affected by age (690-734 days), but presented a trend (t test, p=0.22) for increasing values between 735 and 780 days. Animal age did not affect other quality traits (t test, p>0.20). It was concluded that the rib cut from Nelore young bulls may not have a good acceptability in exigent markets, and that carcasses graded B, presumed to be the best grade, do not necessarily present the best meat quality characteristics.
Resumo:
A wild strain of Streptococcus thermophilus isolated from pasteurized milk was evaluated using an experimental model with respect to its adhesion onto stainless steel surfaces and its behaviour when submitted to cleansing and sanification. In milk, the adhesion of the microorganism on to stainless steel surfaces was studied after 6 hours of contact at 45°C with agitation, and after a cleansing process involving cleaning stages with alkaline and acid detergents followed by sanification, in order to evaluate the resistance of the adhered cells. The microorganism adhered to stainless steel surfaces producing a cell load of 10(4) CFU/cm². After alkaline cleansing, no adhered cells were detected but 6 CFU/cm² were still detected on the surfaces after acid cleansing. Cleansing, followed by sanification with sodium hypochlorite, was sufficient to reduce the load of wild S. thermophilus on the stainless steel surfaces to non-detectable levels. The experimental model proved adequate for the study indicating that the wild microorganism S. thermophilus produces biofilms on stainless steel surfaces. Alkaline cleansing remove more that 99.9% of the adhered cells. The few cells adhered on the surface are removed by acid cleansing demonstrating the need to use different steps and types of detergent for efficient cleansing. The best results for the removal of these biofilms are obtained by using alkaline cleansing followed by acid cleaning, this procedure being more efficient when complemented by sanification with sodium hypochlorite.
Resumo:
This work investigated the cytotoxic and genotoxic potential of water from the River Paraíba do Sul (Brazil) using Allium cepa roots. An anatomo-morphological parameter (root length), mitotic indices, and frequency of micronuclei were analysed. Eight bulbs were chosen at random for treatment for 24 to 120 hours with the River water collected in the years of 2005 and 2006 from sites in the cities of Tremembé and Aparecida (São Paulo state, Brazil). Daily measurements of the length of the roots grown from each bulb were carried out throughout the experiment. Mitotic index (MI) and frequency of micronuclei (MN) were determined for 2000 cells per root, using 3-5 root tips from other bulbs (7-10). Only in the roots treated with samples of the River water collected in 2005 in Tremembé city was there a decrease in the root length growth compared to the respective control. However, a reduction in MI values was verified for both sites analysed for that year. Considering the data involving root length growth and especially MI values, a cytotoxic potential is suggested for the water of the River Paraíba do Sul at Tremembé and Aparecida, in the year of 2005. On the other hand, since in this year the MN frequency was not affected with the river water treatments, genotoxicity is not assumed for the river water sampled at the aforementioned places.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
This paper describes a topiramate induced acute bilateral angle-closure glaucoma. This rare adverse effect is an idiosyncratic reaction characterized by uveal effusion and lens forward displacement, leading to increased intraocular pressure and vision loss. We describe a 55 year-old white woman with migraine, spasmodic torticollis and essential tremor, who developed bilateral acute angle-closure glaucoma, one week after starting topiramate 25 mg/day. She was seen at the Ophthalmology Emergency Department of the Fundação João Penido Burnier (Campinas, SP, Brazil) with a 4 hours history of blurry vision, ocular pain and bright flashes vision. Slit lamp examination revealed moderate conjunctival injection and corneal edema, and shallow anterior chambers. Intraocular pressure was 48 mmHg in both eyes. Fundoscopic examination findings were normal. She was treated with timolol, brimonidine, dorzolamide, pilocarpine, prednisone acetate eye drops and acetazolamide. One hour after those measures, as the intraocular pressure was 30 mmHg, she received a manitol intravenous injection and the intraocular pressure normalized. After 24 hours an iridotomy with Yag laser was performed. Topiramate was discontinued and she was totally recovered after one week.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física