980 resultados para SV40 promoter


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The promoter of the bean PAL2 gene (encoding phenylalanine ammonia-lyase; EC 4.3.1.5) is a model for studies of tissue-restricted gene expression in plants. Petal epidermis is one of the tissues in which this promoter is activated in tobacco. Previous work suggested that a major factor establishing the pattern of PAL2 expression in tobacco petals is the tissue distribution of a protein closely related to Myb305, which is a Myb-like transcriptional activator from snapdragon. In the present work, we show that Myb305 expression in tobacco leaves causes ectopic activation of the PAL2 promoter. To achieve Myb305 expression in planta, a viral expression vector was used. This approach combines the utility of transient assays with the possibility of direct biochemical detection of the introduced factor and may have wider application for studying the function of plant transcription factors.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Granzyme B serine protease is found in the granules of activated cytotoxic T cells and in natural and lymphokine-activated killer cells. This protease plays a critical role in the rapid induction of target cell DNA fragmentation. The DNA regulatory elements that are responsible for the specificity of granzyme B gene transcription in activated T-cells reside between nt -148 and +60 (relative to the transcription start point at +1) of the human granzyme B gene promoter. This region contains binding sites for the transcription factors Ikaros, CBF, Ets, and AP-1. Mutational analysis of the human granzyme B promoter reveals that the Ikaros binding site (-143 to -114) and the AP-1/CBF binding site (-103 to -77) are essential for the activation of transcription in phytohemagglutinin-activated peripheral blood lymphocytes, whereas mutation of the Ets binding site does not affect promoter activity in these cells.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Feedback regulation of transcription from the low density lipoprotein (LDL) receptor gene is fundamentally important in the maintenance of intracellular sterol balance. The region of the LDL receptor promoter responsible for normal sterol regulation contains adjacent binding sites for the ubiquitous transcription factor Sp1 and the cholesterol-sensitive sterol regulatory element-binding proteins (SREBPs). Interestingly, both are essential for normal sterolmediated regulation of the promoter. The cooperation by Sp1 and SREBP-1 occurs at two steps in the activation process. SREBP-1 stimulates the binding of Sp1 to its adjacent recognition site in the promoter followed by enhanced stimulation of transcription after both proteins are bound to DNA. In the present report, we have defined the protein domains of Sp1 that are required for both synergistic DNA binding and transcriptional activation. The major activation domains of Sp1 that have previously been shown to be essential to activation of promoters containing multiple Sp1 sites are required for activation of the LDL receptor promoter. Additionally, the C domain is also crucial. This slightly acidic approximately 120-amino acid region is not required for efficient synergistic activation by multiple Sp1 sites or in combination with other recently characterized transcriptional regulators. We also show that Sp1 domain C is essential for full, enhanced DNA binding by SREBP-1. Taken together with other recent studies on the role of Sp1 in promoter activation, the current experiments suggest a unique combinatorial mechanism for promoter activation by two distinct transcription factors that are both essential to intracellular cholesterol homeostasis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The suppressor of Hairy-wing [su(Hw)] protein exerts a polar effect on gene expression by repressing the function of transcriptional enhancers located distally from the promoter with respect to the location of su(Hw) binding sequences. The directionality of this effect suggests that the su(Hw) protein specifically interferes with the basic mechanism of enhancer action. Moreover, mutations in modifier of mdg4 [mod(mdg4)] result in the repression of expression of a gene when the su(Hw) protein is bound to sequences in the copy of this gene located in the homologous chromosome. This effect is dependent on the presence of the su(Hw) binding region from the gypsy retrotransposon in at least one of the chromosomes and is enhanced by the presence of additional gypsy sequences in the other homology. This phenomenon is inhibited by chromosomal rearrangements that disrupt pairing, suggesting that close apposition between the two copies of the affected gene is important for trans repression of transcription. These results indicate that, in the absence of mod-(mdg4) product, the su(Hw) protein present in one chromosome can act in trans and inactivate enhancers located in the other homolog.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Ear3/COUP is an orphan member of the steroid/thyroid hormone receptor superfamily of transcription factors and binds most tightly to a direct repeat of AGGTCA with 1 nucleotide in between (DR1). Ear3/COUP also binds with a similar affinity to the palindromic thyroid hormone response element (TRE). This binding preference of Ear3/COUP is same as that of the retinoid X receptor (RXR), which is another member of the superfamily. In the present study, we identified a sequence responsible for Ear3/COUP-mediated transactivation in the region downstream of the transcription start site of the mouse mammary tumor virus promoter. This cis-acting sequence was unresponsive to RXR. When the DR1 or TRE sequence was added upstream of the promoter, transactivation by Ear3/COUP was completely abolished, whereas RXR enhanced transcription from the promoter. The mode of action of Ear3/COUP could be utilized to control complex gene expressions in morphogenesis, homeostasis, and development.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We have identified a naturally occurring mutation in the promoter of the lipoprotein lipase (LPL) gene. One of 20 patients with familial combined hyperlipidemia (FCHL) and reduced levels of postheparin plasma LPL activity was found to be a heterozygote carrier of this mutation. The mutation, a T-->C substitution at nt -39, occurred in the binding site of the transcription factor Oct-1. As a result, the transcriptional activity of the mutant promoter was < 15% of wild type, as determined by transfection studies in the human macrophage-like cell line THP-1. This decrease in promoter activity was observed in undifferentiated as well as in phorbol ester-differentiated THP-1 cells. Furthermore, the inductive effect of elevating the levels of intracellular cAMP was equally reduced. This mutation was not present among 20 FCHL patients with normal plasma LPL levels nor has it been reported among individuals with familial LPL deficiency. Thus, heterozygosity for LPL promoter mutations may be one of several factors that contribute to the etiology of FCHL.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Conditional oncogene expression in transgenic mice is of interest for studying the oncoprotein requirements during tumorigenesis and for deriving cell lines that can be induced to undergo growth arrest and enhance their differentiated functions. We utilized the bacterial tetracycline (Tet)-resistance operon regulatory system (tet) from Tn10 of Escherichia coli to control simian virus 40 (SV40) large tumor (T) antigen (TAg) gene expression and to generate conditionally transformed pancreatic beta cells in transgenic mice. A fusion protein containing the tet repressor (tetR) and the activating domain of the herpes simplex virus protein VP16, which converts the repressor into a transcription activator, was produced in beta cells of transgenic mice under control of the insulin promoter. In a separate lineage of transgenic mice, the TAg gene was introduced under control of a tandem array of tet operator sequences and a minimal promoter, which by itself is not sufficient for gene expression. Mice from the two lineages were then crossed to generate double-transgenic mice. Expression of the tetR fusion protein in beta cells activated TAg transcription, resulting in the development of beta-cell tumors. Tumors arising in the absence of Tet were cultured to derive a stable beta-cell line. Cell incubation in the presence of Tet led to inhibition of proliferation, as shown by decreased BrdUrd and [3H]thymidine incorporation. The Tet derivative anhydrotetracycline showed a 100-fold stronger inhibition compared with Tet. When administered in vivo, Tet efficiently inhibited beta-cell proliferation. These findings indicate that transformed beta cells selected for growth during a tumorigenesis process in vivo maintain a dependence on the continuous presence of the TAg oncoprotein for their proliferation. This system provides an approach for generation of beta-cell lines for cell therapy of diabetes as well as conditionally transformed cell lines from other cell types of interest.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Flagellin is one of the most abundant proteins in motile bacteria, yet its expression requires a low abundance sigma factor (sigma 28). We show that transcription from the Bacillus subtilis flagellin promoter is stimulated 20-fold by an upstream A+T-rich region [upstream promoter (UP) element] both in vivo and in vitro. This UP element is contacted by sigma 28 holoenzyme bound at the flagellin promoter and binds the isolated alpha 2 subassembly of RNA polymerase. The UP element increases the affinity of RNA polymerase for the flagellin promoter and stimulates transcription when initiation is limited by the rate of RNA polymerase binding. Comparison with other promoters in the flagellar regulon reveals a bipartite architecture: the -35 and -10 elements confer specificity for sigma 28, while promoter strength is determined largely by upstream DNA sequences.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Os microRNAs (miRNAs) são pequenos RNAs endógenos não codantes de 21-24 nucleotídeos (nt) que regulam a expressão gênica de genes-alvos. Eles estão envolvidos em diversos aspectos de desenvolvimento da planta, tanto na parte aérea, quanto no sistema radicular. Entre os miRNAs, o miRNA156 (miR156) regula a família de fatores de transcrição SQUAMOSA Promoter-Binding Protein-Like (SPL) afetando diferentes processos do desenvolvimento vegetal. Estudos recentes mostram que a via gênica miR156/SPL apresenta efeito positivo tanto no aumento da formação de raízes laterais, quanto no aumento de regeneração de brotos in vitro a partir de folhas e hipocótilos em Arabidopsis thaliana. Devido ao fato de que a origem da formação de raiz lateral e a regeneração in vitro de brotos a partir de raiz principal compartilham semelhanças anatômicas e moleculares, avaliou-se no presente estudo se a via miR156/SPL, da mesma forma que a partir de explantes aéreos, também é capaz de influenciar na regeneração de brotos in vitro a partir de explantes radiculares. Para tanto foram comparados taxa de regeneração, padrão de distribuição de auxina e citocinina, análises histológicas e histoquímicas das estruturas regeneradas em plantas com via miR156/SPL alterada, incluindo planta mutante hyl1, na qual a produção desse miRNA é severamente reduzida. Além disso, foi avaliado o padrão de expressão do miR156 e específicos genes SPL durante a regeneração de brotos in vitro a partir da raiz principal de Arabidopsis thaliana. No presente trabalho observou-se que a alteração da via gênica miR156/SPL é capaz de modular a capacidade de regeneração de brotos in vitro a partir de raiz principal de Arabidopsis thaliana e a distribuição de auxina e citocinina presente nas células e tecidos envolvidos no processo de regeneração. Plantas superexpressando o miR156 apresentaram redução no número de brotos regenerados, além de ter o plastochron reduzido quando comparado com plantas controle. Adicionalmente, plantas contento o gene SPL9 resistente à clivagem pelo miR156 (rSPL9) apresentaram severa redução na quantidade de brotos, além de terem o plastochron alongado. Interessantemente, plantas mutantes hyl1-2 e plantas rSPL10 não apresentaram regeneração de brotos ao longo da raiz principal, mas sim intensa formação de raízes laterais e protuberâncias, respectivamente, tendo essa última apresentado indícios de diferenciação celular precoce. Tomados em conjunto os dados sugerem que o miR156 apresenta importante papel no controle do processo de regeneração de brotos in vitro. Entretanto, esse efeito é mais complexo em regeneração in vitro a partir de raízes do que a partir de cotilédones ou hipocótilos.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The low temperature water–gas shift (WGS) reaction has been studied over Ni–CeO2/Graphene and Ni/Graphene. The catalysts were prepared with 5 wt.% Ni and 20 wt.% CeO2 loadings, by deposition-precipitation employing sodium hydroxide and urea as precipitating agents. The materials were characterized by TEM, powder X-ray diffraction, Raman spectroscopy, H2-temperature-programmed reduction and X-ray photoelectron spectroscopy (XPS). The characterization and the reaction results indicated that the interaction between the active species and the support is higher than with activated carbon, and this hinders the reducibility of ceria and thus the catalytic performance. On the other hand, the presence of residual sodium in samples prepared by precipitation with NaOH facilitated the reduction of ceria. The catalytic activity was highly improved in the presence of sodium, what can be explained on the basis of an associative reaction mechanism which is favored over Ni-O-Na entities.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The paper offers an analysis of the degree to which two different external policy frameworks of the European Union (EU) have institutionalised and operationalised the EU’s commitment to women’s rights and gender equality. It compares the EU’s relations with the African Caribbean and Pacific (ACP) countries with the Euro-Mediterranean Partnership (EMP), using Senegal and Morocco as case studies. Although the comparison shows some resemblances between the two cases, as a whole women’s rights seem more deeply embedded in the institutional framework of EU-ACP relations than that of Euro-Mediterranean relations, and this together with the EU’s approach towards implementation has enabled its women’s rights policy to be slightly more influential on the ground in Senegal than in Morocco. However, both EU-ACP and EMP frameworks have their limits, reflecting the more general problem of inconsistency between the EU’s declaratory objectives and its actual promotion of human rights.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

One of the hallmarks of cancer is its unlimited replicative potential that needs a compensatory mechanism for the consequential telomere erosion. Telomerase promoter (TERTp) mutations were recently reported as a novel mechanism for telomerase re-activation/expression in order to maintain telomere length. Pancreatic endocrine tumors (PETs) were so far recognized to rely mainly on the alternative lengthening of telomeres (ALT) mechanism. It was our objective to study if TERTp mutations were present in pancreatic endocrine tumors (PET) and could represent an alternative mechanism to ALT. TERTp mutations were detected in 7% of the cases studied and were mainly associated to patients harbouring hereditary syndromes. In vitro, using PET-derived cell lines and by luciferase reporter assay, these mutations confer a 2 to 4-fold increase in telomerase transcription activity. These novel alterations are able to recruit ETS transcription factor members, in particular GABP-α and ETV1, to the newly generated binding sites. We report for the first time TERTp mutations in PETs and PET-derived cell lines. Additionally, our data indicate that these mutations serve as an alternative mechanism and in an exclusive manner to ALT, in particular in patients with hereditary syndromes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

During the blood meal of a Plasmodium-infected mosquito, 10 to 100 parasites are inoculated into the skin and a proportion of these migrate via the bloodstream to the liver where they infect hepatocytes. The Plasmodium liver stage, despite its clinical silence, represents a highly promising target for antimalarial drug and vaccine approaches. Successfully invaded parasites undergo a massive proliferation in hepatocytes, producing thousands of merozoites that are transported into a blood vessel to infect red blood cells. To successfully develop from the liver stage into infective merozoites, a tight regulation of gene expression is needed. Although this is a very interesting aspect in the biology of Plasmodium, little is known about gene regulation in Plasmodium parasites in general and in the liver stage in particular. We have functionally analyzed a novel promoter region of the rodent parasite Plasmodium berghei that is exclusively active during the liver stage of the parasite. To prove stage-specific activity of the promoter, GFP and luciferase reporter assays have been successfully established, allowing both qualitative and accurate quantitative analysis. To further characterize the promoter region, the transcription start site was mapped by rapid amplification of cDNA ends (5'-RACE). Using promoter truncation experiments and site-directed mutagenesis within potential transcription factor binding sites, we suggest that the minimal promoter contains more than one binding site for the recently identified parasite-specific ApiAP2 transcription factors. The identification of a liver stage-specific promoter in P. berghei confirms that the parasite is able to tightly regulate gene expression during its life cycle. The identified promoter region might now be used to study the biology of the Plasmodium liver stage, which has thus far proven problematic on a molecular level. Stage-specific expression of dominant-negative mutant proteins and overexpression of proteins normally active in other life cycle stages will help to understand the function of the proteins investigated.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The appendix (p. 45-67) comprises short reports and letters from Alden Partridge, William Eustis, Robert R. Livingston, John Stranger, S. H. Long, Thomas Jefferson, J. Priestley, Horatio Gates and Lindley Murray.