Tecniche geomatiche di reverse engineering nel campo dei Beni Culturali

La salvaguardia e conservazione del Patrimonio Artistico ed Architettonico rappresentano un aspetto imprescindibile di ogni cultura, e trovano le loro fondamenta nella coscienza e conoscenza dei Beni. Il rilievo è l’operazione basilare per acquisire una conoscenza rigorosa di un oggetto nella sua geometria e in altre sue caratteristiche. Le finalità delle operazioni di rilevamento sono molteplici, dall’archiviazione a scopo di documentazione fino all’indagine conservativa volta alla diagnostica e alla progettazione di interventi. I modelli digitali, introdotti dallo sviluppo tecnologico degli ultimi decenni, permettono una perfetta conoscenza del bene, non necessitano di contatto diretto durante la fase di rilevamento e possono essere elaborati secondo le esigenze del caso. Le tecniche adottate nel Reverse Engineering si differenziano per il tipo di sensore utilizzato: quelle fotogrammetriche utilizzano sensori di tipo “passivo” e trovano oggi largo impiego nel settore dei Beni Culturali grazie agli strumenti di Structure from Motion, mentre strumenti basati su sensori di tipo “attivo” utilizzano Laser o proiezione di luce strutturata e sono in grado di rilevare con grande precisione geometrie anche molto complesse. La costruzione del modello della fontana del Nettuno e della torre Garisenda di Bologna costituiscono un valido esempio di applicazione delle tecniche di rilievo digitale, e dimostrano la validità delle stesse su oggetti di diversa dimensione in due diversi ambiti applicativi: il restauro e il monitoraggio. Gli sviluppi futuri del Reverse Engineering in questo ambito sono molteplici, e la Geomatica rappresenta senza dubbio una disciplina fondamentale per poterli realizzare.

Conformational states of HIV-1 reverse transcriptase for nucleotide incorporation vs. pyrophosphorolysis – binding of foscarnet

HIV-1 reverse transcriptase (RT) catalytically incorporates individual nucleotides into a viral DNA strand complementing an RNA or DNA template strand; the polymerase active site of RT adopts multiple conformational and structural states while performing this task. The states associated are dNTP binding at the N site, catalytic incorporation of a nucleotide, release of a pyrophosphate, and translocation of the primer 3′-end to the P site. Structural characterization of each of these states may help in understanding the molecular mechanisms of drug activity and resistance and in developing new RT inhibitors. Using a 38-mer DNA template-primer aptamer as the substrate mimic, we crystallized an RT/dsDNA complex that is catalytically active, yet translocation-incompetent in crystals. The ability of RT to perform dNTP binding and incorporation in crystals permitted obtaining a series of structures: (I) RT/DNA (P-site), (II) RT/DNA/AZTTP ternary, (III) RT/AZT-terminated DNA (N-site), and (IV) RT/AZT-terminated DNA (N-site)/foscarnet complexes. The stable N-site complex permitted the binding of foscarnet as a pyrophosphate mimic. The Mg2+ ions dissociated after catalytic addition of AZTMP in the pretranslocated structure III, whereas ions A and B had re-entered the active site to bind foscarnet in structure IV. The binding of foscarnet involves chelation with the Mg2+ (B) ion and interactions with K65 and R72. The analysis of interactions of foscarnet and the recently discovered nucleotide-competing RT inhibitor (NcRTI) α-T-CNP in two different conformational states of the enzyme provides insights for developing new classes of polymerase active site RT inhibitors.

Analisi multi-obiettivo in ottica lean-green della reverse logistics dei veicoli a fine vita (ELV)

La gestione del fine vita dei prodotti è un argomento di interesse attuale per le aziende; sempre più spesso l’imprese non possono più esimersi dall’implementare un efficiente sistema di Reverse Logistics. Per rispondere efficacemente a queste nuove esigenze diventa fondamentale ampliare i tradizionali sistemi logistici verso tutte quelle attività svolte all’interno della Reverse Logitics. Una gestione efficace ed efficiente dell’intera supply chain è un aspetto di primaria importanza per un’azienda ed incide notevolmente sulla sua competitività; proprio per perseguire questo obiettivo, sempre più aziende promuovono politiche di gestione delle supply chain sia Lean che Green. L’obiettivo di questo lavoro, nato dalle esigenze descritte sopra, è quello di applicare un modello innovativo che consideri sia politiche di gestione Lean, che dualmente politiche Green, alla gestione di una supply chain del settore automotive, comprendente anche le attività di gestione dei veicoli fuori uso (ELV). Si è analizzato per prima cosa i principi base e gli strumenti utilizzati per l’applicazione della Lean Production e del Green supply chain management e in seguito si è analizzato le caratteristiche distintive della Reverse Logistics e in particolare delle reti che trattano i veicoli a fine vita. L’obiettivo finale dello studio è quello di elaborare e implementare, tramite l’utilizzo del software AMPL, un modello di ottimizzazione multi-obiettivo (MOP- Multi Objective Optimization) Lean e Green a una Reverse Supply Chain dei veicoli a fine vita. I risultati ottenuti evidenziano che è possibile raggiungere un ottimo compromesso tra le due logiche. E' stata effettuata anche una valutazione economica dei risultati ottenuti, che ha evidenziato come il trade-off scelto rappresenti anche uno degli scenari con minor costi.

Intermittent Fasting Induces Hypothalamic Modifications Resulting In Low Feeding Efficiency, Low Body Mass And Overeating.

Intermittent fasting (IF) is an often-used intervention to decrease body mass. In male Sprague-Dawley rats, 24 hour cycles of IF result in light caloric restriction, reduced body mass gain, and significant decreases in the efficiency of energy conversion. Here, we study the metabolic effects of IF in order to uncover mechanisms involved in this lower energy conversion efficiency. After 3 weeks, IF animals displayed overeating during fed periods and lower body mass, accompanied by alterations in energy-related tissue mass. The lower efficiency of energy use was not due to uncoupling of muscle mitochondria. Enhanced lipid oxidation was observed during fasting days, whereas fed days were accompanied by higher metabolic rates. Furthermore, an increased expression of orexigenic neurotransmitters AGRP and NPY in the hypothalamus of IF animals was found, even on feeding days, which could explain the overeating pattern. Together, these effects provide a mechanistic explanation for the lower efficiency of energy conversion observed. Overall, we find that IF promotes changes in hypothalamic function that explain differences in body mass and caloric intake.

Diet Carotenoid Lutein Modulates The Expression Of Genes Related To Oxygen Transporters And Decreases Dna Damage And Oxidative Stress In Mice.

Lutein (LT) is a carotenoid obtained by diet and despite its antioxidant activity had been biochemically reported, few studies are available concerning its influence on the expression of antioxidant genes. The expression of 84 genes implicated in antioxidant defense was quantified using quantitative reverse transcription polymerase chain reaction array. DNA damage was measured by comet assay and glutathione (GSH) and thiobarbituric acid reactive substances (TBARS) were quantified as biochemical parameters of oxidative stress in mouse kidney and liver. cDDP treatment reduced concentration of GSH and increased TBARS, parameters that were ameliorated in treatment associated with LT. cDDP altered the expression of 32 genes, increasing the expression of GPx2, APC, Nqo1 and CCs. LT changed the expression of 37 genes with an induction of 13 mainly oxygen transporters. In treatments associating cDDP and LT, 30 genes had their expression changed with a increase of the same genes of the cDDP treatment alone. These results suggest that LT might act scavenging reactive species and also inducing the expression of genes related to a better antioxidant response, highlighting the improvement of oxygen transport. This improved redox state of the cell through LT treatment could be related to the antigenotoxic and antioxidant effects observed.

Two-component System Vicrk Regulates Functions Associated With Establishment Of Streptococcus Sanguinis In Biofilms.

Streptococcus sanguinis is a commensal pioneer colonizer of teeth and an opportunistic pathogen of infectious endocarditis. The establishment of S. sanguinis in host sites likely requires dynamic fitting of the cell wall in response to local stimuli. In this study, we investigated the two-component system (TCS) VicRK in S. sanguinis (VicRKSs), which regulates genes of cell wall biogenesis, biofilm formation, and virulence in opportunistic pathogens. A vicK knockout mutant obtained from strain SK36 (SKvic) showed slight reductions in aerobic growth and resistance to oxidative stress but an impaired ability to form biofilms, a phenotype restored in the complemented mutant. The biofilm-defective phenotype was associated with reduced amounts of extracellular DNA during aerobic growth, with reduced production of H2O2, a metabolic product associated with DNA release, and with inhibitory capacity of S. sanguinis competitor species. No changes in autolysis or cell surface hydrophobicity were detected in SKvic. Reverse transcription-quantitative PCR (RT-qPCR), electrophoretic mobility shift assays (EMSA), and promoter sequence analyses revealed that VicR directly regulates genes encoding murein hydrolases (SSA_0094, cwdP, and gbpB) and spxB, which encodes pyruvate oxidase for H2O2 production. Genes previously associated with spxB expression (spxR, ccpA, ackA, and tpK) were not transcriptionally affected in SKvic. RT-qPCR analyses of S. sanguinis biofilm cells further showed upregulation of VicRK targets (spxB, gbpB, and SSA_0094) and other genes for biofilm formation (gtfP and comE) compared to expression in planktonic cells. This study provides evidence that VicRKSs regulates functions crucial for S. sanguinis establishment in biofilms and identifies novel VicRK targets potentially involved in hydrolytic activities of the cell wall required for these functions.

Obesity Versus Osteoarthritis: Beyond The Mechanical Overload.

Obesity is currently considered a major public health problem in the world, already reaching epidemic characteristics, according to the World Health Organization. Excess weight is the major risk factor associated with various diseases, such as type 2 diabetes mellitus, hypertension, dyslipidemia and osteometabolic diseases, including osteoporosis and osteoarthritis. Osteoarthritis is the most prevalent rheumatic disease and the leading cause of physical disability and reduced quality of life of the population over 65 years. It mainly involves the joints that bear weight - knees and hips. However, along with the cases of obesity, its prevalence is increasing, and even in other joints, such as hands. Thus, it is assumed that the influence of obesity on the development of OA is beyond mechanical overload. The purpose of this review was to correlate the possible mechanisms underlying the genesis and development of these two diseases. Increased fat mass is directly proportional to excessive consumption of saturated fatty acids, responsible for systemic low-grade inflammation condition and insulin and leptin resistance. At high levels, leptin assumes inflammatory characteristics and acts in the articular cartilage, triggering the inflammatory process and changing homeostasis this tissue with consequent degeneration. We conclude that obesity is a risk factor for osteoarthritis and that physical activity and changes in diet composition can reverse the inflammatory and leptin resistance, reducing progression or preventing the onset of osteoarthritis.

Post Hoc Analysis Of The Patricia Randomized Trial Of The Efficacy Of Human Papillomavirus Type 16 (hpv-16)/hpv-18 As04-adjuvanted Vaccine Against Incident And Persistent Infection With Nonvaccine Oncogenic Hpv Types Using An Alternative Multiplex Type-specific Pcr Assay For Hpv Dna.

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

[effect Of Ropivacaine Combined With Pancuronium On Neuromuscular Transmission And Effectiveness Of Neostigmine And 4-aminopyridine For Blockade Reversal: Experimental Study].

The local anesthetic effects on neuromuscular junction and its influence on blockade produced by nondepolarizing neuromuscular blockers are still under-investigated; however, this interaction has been described in experimental studies and in humans. The aim of this study was to evaluate in vitro the interaction between ropivacaine and pancuronium, the influence on transmission and neuromuscular blockade, and the effectiveness of neostigmine and 4-aminopyridine to reverse the blockade. Rats were divided into groups (n=5) according to the study drug: ropivacaine (5μgmL(-1)); pancuronium (2μg.mL(-1)); ropivacaine+pancuronium. Neostigmine and 4-aminopyridine were used at concentrations of 2μgmL(-1) and 20μgmL(-1), respectively. The effects of ropivacaine on membrane potential and miniature end-plate potential, the amplitude of diaphragm responses before and 60minutes after the addition of ropivacaine (degree of neuromuscular blockade with pancuronium and with the association of pancuronium-ropivacaine), and the effectiveness of neostigmine and 4-aminopyridine on neuromuscular block reversal were evaluated. Ropivacaine did not alter the amplitude of muscle response (the membrane potential), but decreased the frequency and amplitude of the miniature end-plate potential. Pancuronium blockade was potentiated by ropivacaine, and partially and fully reversed by neostigmine and 4-aminopyridine, respectively. Ropivacaine increased the neuromuscular block produced by pancuronium. The complete antagonism with 4-aminopyridine suggests presynaptic action of ropivacaine.

Hemodynamic Changes With Two Lipid Emulsions For Treatment Of Bupivacaine Toxicity In Swines.

To compare the hemodynamic changes following two different lipid emulsion therapies after bupivacaine intoxication in swines. Large White pigs were anesthetized with thiopental, tracheal intubation performed and mechanical ventilation instituted. Hemodynamic variables were recorded with invasive pressure monitoring and pulmonary artery catheterization (Swan-Ganz catheter). After a 30-minute resting period, 5 mg.kg-1 of bupivacaine by intravenous injection was administered and new hemodynamic measures were performed 1 minute later; the animals were than randomly divided into three groups and received 4 ml.kg-1 of one of the two different lipid emulsion with standard long-chaim triglyceride, or mixture of long and medium-chain triglyceride, or saline solution. Hemodynamic changes were then re-evaluated at 5, 10, 15, 20 and 30 minutes. Bupivacaine intoxication caused fall in arterial blood pressure, cardiac index, ventricular systolic work index mainly and no important changes in vascular resistances. Both emulsion improved arterial blood pressure mainly increasing vascular resistance since the cardiac index had no significant improvement. On the systemic circulation the hemodynamic results were similar with both lipid emulsions. Both lipid emulsions were efficient and similar options to reverse hypotension in cases of bupivacaine toxicity.

G-quadruplex Formation Enhances Splicing Efficiency Of Pax9 Intron 1.

G-quadruplexes are secondary structures present in DNA and RNA molecules, which are formed by stacking of G-quartets (i.e., interaction of four guanines (G-tracts) bounded by Hoogsteen hydrogen bonding). Human PAX9 intron 1 has a putative G-quadruplex-forming region located near exon 1, which is present in all known sequenced placental mammals. Using circular dichroism (CD) analysis and CD melting, we showed that these sequences are able to form highly stable quadruplex structures. Due to the proximity of the quadruplex structure to exon-intron boundary, we used a validated double-reporter splicing assay and qPCR to analyze its role on splicing efficiency. The human quadruplex was shown to have a key role on splicing efficiency of PAX9 intron 1, as a mutation that abolished quadruplex formation decreased dramatically the splicing efficiency of human PAX9 intron 1. The less stable, rat quadruplex had a less efficient splicing when compared to human sequences. Additionally, the treatment with 360A, a strong ligand that stabilizes quadruplex structures, further increased splicing efficiency of human PAX9 intron 1. Altogether, these results provide evidences that G-quadruplex structures are involved in splicing efficiency of PAX9 intron 1.

Androgen Therapy Reverses Injuries Caused By Ethanol Consumption In The Prostate: Testosterone As A Possible Target To Ethanol-related Disorders.

Chronic ethanol consumption leads to reproductive damages, since it can act directly in the tissues or indirectly, causing a hormonal imbalance. Prostate is a hormone-dependent gland and, consequently, susceptible to ethanol. The potential of testosterone therapy in the ethanol-related disorders was investigated in the prostate microenvironment. UChB rats aged 90 days were divided into 2 experimental groups (n=20): C: drinking water only and EtOH: drinking 10% (v/v) ethanol at >2 g/kg body weight/day+water. At 150 days old, 10 rats from each group received subcutaneous injections of testosterone cypionate (5 mg/kg body weight) diluted in corn oil every other day for 4 weeks, constituting T and EtOH+T, while the remaining animals received corn oil as vehicle. Animals were euthanized at 180 days old, by decapitation. Blood was collected to obtain hormone concentrations and ventral prostate was dissected and processed for light microscope and molecular analyses. Ventral prostate weight, plasma testosterone and DHT and intraprostatic testosterone concentrations were increased after testosterone treatment. Plasma estradiol level was reduced in the EtOH+T. Inflammatory foci, metaplasia and epithelial atrophy were constantly found in the prostate of EtOH and were not observed after hormonal therapy. No differences were found in the expression of AR, ERβ and DACH-1. Additionally, testosterone treatment down-regulated ERα and increased the e-cadherin and α-actinin immunoreactivities. Testosterone was able to reverse damages caused by ethanol consumption in the prostate microenvironment and becomes a possible target to be investigated to ethanol-related disorders.

Is size structure a good measure of future trends of plant populations? an empirical approach using five woody species from the Cerrado (Brazilian savanna)

Size distributions in woody plant populations have been used to assess their regeneration status, assuming that size structures with reverse-J shapes represent stable populations. We present an empirical approach of this issue using five woody species from the Cerrado. Considering count data for all plants of these five species over a 12-year period, we analyzed size distribution by: a) plotting frequency distributions and their adjustment to the negative exponential curve and b) calculating the Gini coefficient. To look for a relationship between size structure and future trends, we considered the size structures from the first census year. We analyzed changes in number over time and performed a simple population viability analysis, which gives the mean population growth rate, its variance and the probability of extinction in a given time period. Frequency distributions and the Gini coefficient were not able to predict future trends in population numbers. We recommend that managers should not use measures of size structure as a basis for management decisions without applying more appropriate demographic studies.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Lesion of the subthalamic nucleus reverses motor deficits but not death of nigrostriatal dopaminergic neurons in a rat 6-hydroxydopamine-lesion model of Parkinson's disease

The objective of the present study was to determine whether lesion of the subthalamic nucleus (STN) promoted by N-methyl-D-aspartate (NMDA) would rescue nigrostriatal dopaminergic neurons after unilateral 6-hydroxydopamine (6-OHDA) injection into the medial forebrain bundle (MFB). Initially, 16 mg 6-OHDA (6-OHDA group) or vehicle (artificial cerebrospinal fluid - aCSF; Sham group) was infused into the right MFB of adult male Wistar rats. Fifteen days after surgery, the 6-OHDA and SHAM groups were randomly subdivided and received ipsilateral injection of either 60 mM NMDA or aCSF in the right STN. Additionally, a control group was not submitted to stereotaxic surgery. Five groups of rats were studied: 6-OHDA/NMDA, 6-OHDA/Sham, Sham/NMDA, Sham/Sham, and Control. Fourteen days after injection of 6-OHDA, rats were submitted to the rotational test induced by apomorphine (0.1 mg/kg, ip) and to the open-field test. The same tests were performed again 14 days after NMDA-induced lesion of the STN. The STN lesion reduced the contralateral turns induced by apomorphine and blocked the progression of motor impairment in the open-field test in 6-OHDA-treated rats. However, lesion of the STN did not prevent the reduction of striatal concentrations of dopamine and metabolites or the number of nigrostriatal dopaminergic neurons after 6-OHDA lesion. Therefore, STN lesion is able to reverse motor deficits after severe 6-OHDA-induced lesion of the nigrostriatal pathway, but does not protect or rescue dopaminergic neurons in the substantia nigra pars compacta.