978 resultados para Field Adult Survival


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of the present study was to determine whether lesion of the subthalamic nucleus (STN) promoted by N-methyl-D-aspartate (NMDA) would rescue nigrostriatal dopaminergic neurons after unilateral 6-hydroxydopamine (6-OHDA) injection into the medial forebrain bundle (MFB). Initially, 16 mg 6-OHDA (6-OHDA group) or vehicle (artificial cerebrospinal fluid - aCSF; Sham group) was infused into the right MFB of adult male Wistar rats. Fifteen days after surgery, the 6-OHDA and SHAM groups were randomly subdivided and received ipsilateral injection of either 60 mM NMDA or aCSF in the right STN. Additionally, a control group was not submitted to stereotaxic surgery. Five groups of rats were studied: 6-OHDA/NMDA, 6-OHDA/Sham, Sham/NMDA, Sham/Sham, and Control. Fourteen days after injection of 6-OHDA, rats were submitted to the rotational test induced by apomorphine (0.1 mg/kg, ip) and to the open-field test. The same tests were performed again 14 days after NMDA-induced lesion of the STN. The STN lesion reduced the contralateral turns induced by apomorphine and blocked the progression of motor impairment in the open-field test in 6-OHDA-treated rats. However, lesion of the STN did not prevent the reduction of striatal concentrations of dopamine and metabolites or the number of nigrostriatal dopaminergic neurons after 6-OHDA lesion. Therefore, STN lesion is able to reverse motor deficits after severe 6-OHDA-induced lesion of the nigrostriatal pathway, but does not protect or rescue dopaminergic neurons in the substantia nigra pars compacta.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJECTIVE: This study aimed to assess the survival and life quality evolution of patients subjected to surgical excision of oral and oropharyngeal squamous cell carcinoma. MATERIAL AND METHODS: Forty-seven patients treated at a Brazilian healthcare unit specialized in head and neck surgery between 2006 and 2007 were enrolled in the study. The gathering of data comprised reviewing hospital files and applying the University of Washington Quality of Life (UW-QOL) questionnaire previously and 1 year after the surgery. Comparative analysis used Poisson regression to assess factors associated with survival and a paired t-test to compare preoperative and 1-year postoperative QOL ratings. RESULTS: 1 year after surgery, 7 patients were not found (dropout of the cohort); 15 had died and 25 fulfilled the UW-QOL again. The risk of death was associated with having regional metastasis previously to surgery (relative risk=2.18; 95% confidence interval=1.09-5.17) and tumor size T3 or T4 (RR=2.30; 95%CI=1.05-5.04). Survivors presented significantly (p<0.05) poorer overall and domain-specific ratings of quality of life. Chewing presented the largest reduction: from 74.0 before surgery to 34.0 one year later. Anxiety was the only domain whose average rating increased (from 36.0 to 70.7). CONCLUSIONS: The prospective assessment of survival and quality of life may contribute to anticipate interventions aimed at reducing the incidence of functional limitations in patients with oral and oropharyngeal cancer.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In order to study the effect of pH on defaunation in the rumen, four rumen fistulated steers were fed a basal roughage diet for a 4-week adaptation period followed by 17 weeks of feeding with three diets and two feeding levels of high concentrate diet. Rumen outflow fluid rate was evaluated in both ration levels. Rumen protozoa population was monitored weekly and when animals became defaunated, protozoa were reinoculated with rumen contents from one of the faunated steers. At every two weeks, during all the experimental period, rumen pH was measured in all animals at 0, 4, 8 and 12 h after feeding. It was observed an individual animal influence on the establishment and maintenance of the rumen ciliate protozoa population. In all sampling times, mean rumen pH values were higher in faunated steers than in the defaunated ones. No differences were observed in rumen outflow fluid rates between the two ration levels. Extended periods of low rumen pH are probably more detrimental to the survival of ciliate protozoa in the rumen than other factors.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A modified version of the intruder-resident paradigm was used to investigate if social recognition memory lasts at least 24 h. One hundred and forty-six adult male Wistar rats were used. Independent groups of rats were exposed to an intruder for 0.083, 0.5, 2, 24, or 168 h and tested 24 h after the first encounter with the familiar or a different conspecific. Factor analysis was employed to identify associations between behaviors and treatments. Resident rats exhibited a 24-h social recognition memory, as indicated by a 3- to 5-fold decrease in social behaviors in the second encounter with the same conspecific compared to those observed for a different conspecific, when the duration of the first encounter was 2 h or longer. It was possible to distinguish between two different categories of social behaviors and their expression depended on the duration of the first encounter. Sniffing the anogenital area (49.9% of the social behaviors), sniffing the body (17.9%), sniffing the head (3%), and following the conspecific (3.1%), exhibited mostly by resident rats, characterized social investigation and revealed long-term social recognition memory. However, dominance (23.8%) and mild aggression (2.3%), exhibited by both resident and intruders, characterized social agonistic behaviors and were not affected by memory. Differently, sniffing the environment (76.8% of the non-social behaviors) and rearing (14.3%), both exhibited mostly by adult intruder rats, characterized non-social behaviors. Together, these results show that social recognition memory in rats may last at least 24 h after a 2-h or longer exposure to the conspecific.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The tolerance to the combined effects of temperature and salinity was investigated in the interstitial isopod Coxicerberus ramosae (Albuquerque, 1978), a species of intertidal zone of sandy beaches in Rio de Janeiro, Brazil. The animals were collected on Praia Vermelha Beach. The experiments lasted 24 h and nine salinities and seven temperatures were used for a total of 63 combinations. Thirty animals were tested in each combination. The species showed high survival in most of the combinations. The temperature of 35 ºC was lethal and at 5 ºC, the animals tolerated only a narrow range of salinities. The statistical analyses showed that the effects of temperature and salinity were significant on the survival, which confirmed the euryhalinity and eurythermy of this species.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Em 1999, as células-tronco foram eleitas "Scientific Breakthrough of the Year" (avanço científico do ano) pela revista Science¹. Naquele ano, foi demonstrado que células-tronco de tecidos adultos mantinham a capacidade de se diferenciar em outros tipos de tecidos. No ano anterior, as primeiras linhagens de células-tronco embrionárias humanas foram estabelecidas. Desde então, o número de artigos científicos sobre células-tronco vem crescendo exponencialmente, onde novos paradigmas são estabelecidos. Neste artigo, farei uma revisão da área de células-tronco com um foco especial em seu uso como agente terapêutico em doenças comuns como diabetes e cardiopatias. As células-tronco serão tratadas em dois grupos distintos: as embrionárias e as adultas. Enquanto o potencial de diferenciação das primeiras está bem caracterizado em camundongos e em humanos, seu uso em terapia celular e em pesquisa tem sido dificultado por questões de histocompatibilidade, segurança e ética. Em contraste, células-tronco adultas não apresentam estes empecilhos, apesar da extensão de sua plasticidade ainda estar sob investigação. Mesmo assim, diversos testes clínicos em humanos estão em andamento utilizando células-tronco adultas, principalmente derivadas da medula óssea. Discutirei ainda a importância de se trabalhar com as duas classes de células-tronco humanas de forma a se cumprir suas promessas terapêuticas.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The clingfish Gobiesox barbatulus shows nocturnal feeding activity, spending most part of the day stationary and adhered to the inferior part of stones. To feed, this species uses the sit-and-wait and particulate feeding tactics. It shows a carnivorous feeding habit mostly consuming small benthic crustaceans. It can move in two ways: (1) "stone-by-stone", sliding its ventral sucker disc across each stone and (2) "surf", when it takes advantage of the energy of the ebbing tide to quickly cross a distance up to four times its body length. Its reproductive season occurs between the end of spring and the beginning of summer, during which time it lays about 2,000 adhesive eggs of 1 mm each in a single layer under stones. It has more than one egg-laying session per reproductive season, therefore showing several different developmental stages. It performs fanning, mouthing and guarding of the eggs as forms of parental care. Data shown here also indicates that G. barbatulus has some shelter fidelity, being probably territorial.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In order to verify the influence of chronic and acute ambient oxygen levels from egg to adult stage of the zebrafish, in vivo oxygen consumption (MO2), critical tensions of oxygen (Pcrit), heart rate (fH) and total body lactate concentration (Lc) were determined for Danio rerio (Hamilton, 1822) raised at 28 °C under normoxic (7.5 mgO2.L-1 or 80 mm.Hg-1) and hypoxic conditions (4.3 mgO2.L-1) and exposed to acute hypoxia during different developmental stages. Our findings confirmed that very early stages do not respond effectively to ambient acute hypoxia. However, after the stage corresponding to the age of 30 days, D. rerio was able to respond to acute hypoxia through effective physiological mechanisms involving aerobic and anaerobic metabolism. Such responses were more efficient for the fishes reared under hypoxia which showed that D. rerio survival capability increased during acclimation to mild hypoxia. Measurements of body mass and length showed that moderate hypoxia did not affect growth significantly until the fish reached the stage of 60 days. Moreover, a growth delay was verified for the hypoxic-reared animals. Also, the D. rerio eggs-to-larvae survival varied from 87.7 to 62.4% in animals reared under normoxia and mild hypoxia, respectively. However, the surviving animals raised under moderated hypoxia showed a better aptitude to regulate aerobic and anaerobic capacities when exposed to acute hypoxia.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Em pesquisa de campo realizada no interior do Estado do Espírito Santo, Brasil, em janeiro de 2006, como parte de projeto sobre a transmissão de Plasmodium, foram coletadas larvas de anofelinos em bromélias. Os imaturos foram mantidos no laboratório até a obtenção dos adultos machos e fêmeas associados com as exúvias das larvas e das pupas, para serem identificados. Conseqüentemente, verificou-se que dois espécimes pertenciam a Anopheles (Kerteszia) homunculus Komp, 1937. Este é o primeiro registro dessa espécie de Kerteszia no Espírito Santo. O encontro evidencia a importância de estudos adicionais de modo a estabelecer a distribuição geográfica do An. homunculus, bem como o status taxonômico e a importância epidemiológica da espécie na dinâmica da transmissão da malária em áreas de Mata Atlântica.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The dispersal and survival of the phlebotomines Nyssomyia intermedia and Nyssomyia neivai (both implicated as vectors of the cutaneous leishmaniasis agent) in an endemic area was investigated using a capture-mark-release technique in five experiments from August-December 2003 in municipality of Iporanga, state of São Paulo, Brazil. A total of 1,749 males and 1,262 females of Ny. intermedia and 915 males and 411 females of Ny. neivai were marked and released during the five experiments. Recapture attempts were made using automatic light traps, aspiration in natural resting places and domestic animal shelters and Shannon traps. A total of 153 specimens (3.48%) were recaptured: 2.59% (78/3,011) for Ny. intermedia and 5.35% (71/1,326) for Ny. neivai. Both species were recaptured up to 144 h post-release, with the larger part of them recaptured within 48 h. The median dispersion distances for Ny. intermedia and Ny. neivai, respectively, were 109 m and 100 m. The greatest dispersal range of Ny. intermedia was 180 m, while for Ny. neivai one female was recaptured in a pasture at 250 m and another in a pigsty at 520 m, showing a tendency to disperse to more open areas. The daily survival rates calculated based on regressions of the numbers of marked insects recaptured on the six successive days after release were 0.746 for males and 0.575 for females of Ny. intermedia and 0.649 for both sexes of Ny. neivai. The size of the populations in the five months ranged from 8,332-725,085 for Ny. intermedia males, 2,193-104,490 for Ny. intermedia females, 1,687-350,122 for Ny. neivai males and 254-49,705 for Ny. neivai females.