Sistema MINUS® - técnica minimamente invasiva para o tratamento das fraturas transtrocanterianas do fêmur

The MINUS system was developed as a minimally invasive procedure that uses a diaphyseal cephalic extramedullary implant for the treatment of transtrochanteral fractures of the femur in elderly patients. The implant consists of a sliding screw coupled to a plate adapted to the minimally invasive technique. The surgical access is approximately three centimeters in length located on the lateral surface of the hip, below the projection of the small trochanter. A perfectly adapted instrument was used for the procedure, which also requires the use of an image intensifier, reducing surgery time and rate of bleeding. The objective of this study is to present a new instrument and implant, developed specifically for treatment with the minimally invasive technique, reducing the length of the conventional surgical access from 10 to three centimetres. This new implant was given the commercial name of MINUS System.

Estilos motivacionais de professores: propriedades psicométricas de um instrumento de avaliação

The purpose of this study was to conduct an exploratory factorial analysis of Problems in School, a teachers' motivational styles evaluation instrument, constructed by Deci et al. The original instrument is in a Likert-scale format with the underlying assumption of the existence of a continuum of four different styles contributing to promote students' autonomy. Translated into portuguese, the instrument was applied to 582 elementary and junior high school teachers from several regions of Brazil. Factorial analyses revealed a solution with four orthogonal distinct factors, the authors' initial supposition (existence of a continuum) was not confirmed. In fact, only two opposite styles (both high promotion of autonomy and of control) corresponded to the Deci et al. original ideas. Problems regarding the validity of the other remaining styles emerged. Data was discussed and a revised version of the scale was developed. Directions for further research were also suggested.

Resonancias discursivas y cortesía en prácticas de lecto-escritura

In this paper we present a study of reading comprehension based on a contrastive argumentative-discursive approach. We examine the relationship between linguistic materiality and discursive processes, observing the connection between reading in a foreign language, writing production and textual memories in the mother tongue. In addition to an interest in practical language teaching and learning processes (in this case of Spanish and Portuguese), we investigate the question of politeness and the theoretical relationship between subjectivity, language, and textuality. The latter, being understood as the result of discourse regularities, is unique for each and every production, yet is also conditioned by plural discursive memories resulting from contradictory social relationships in a specific historical context (Foucault, 1986; Pêcheux, 1990). In the experiment presented here, we follow some of the procedures of the methodology applied in the European Galatea Project developed for the study of reading strategies in the inter-comprehension between Romance languages (Dabène, 1996). We use the procedure of simulation and the subjective projection of participants as well as the notion of discursive resonance in the analysis. The results, having to do with directness and indirectness in speech and the question of politeness in two typologically close languages, lead to the conclusion that the concept of politeness goes beyond a pragmatic strategy used to avoid conflicts to be approached as a marker of cultural identity constitution. The relevance of discursive awareness and its theoretical and practical consequences are then emphasized.

A evolução da noção de parâmetros

This paper presents an overview of the concept of parameter in the Principles and Parameters theory, showing that a) in the first stage parameters were conceived as variation associated to the Principles and b) in the second stage as properties of the lexicon, and more specifically as properties of functional categories. The latter view has also developed from a substantive conception of functional categories to a more formal abstract characterization of functional heads. The paper also discusses parameters related to different levels of representation.

Modelos organizadores do pensamento: uma perspectiva de pesquisa sobre o raciocínio moral com adolescentes autores de infração

This article has the aim to expand the perspective of research in the field of morality. We present a proposal of morality study of outlaw teenagers according to Thinking Organizer Models Theory. Through the idea of complexity we search to understand the cognitive process in the elaboration of moral reasoning inside situations of conflict. With this perspective, we developed a research that aimed to identify which organizer models were applied by 20 outlaw male teenagers who abide by social punishment to solve the hypothetical moral conflicts. Through interviews we told them a situation of moral conflict that involved friendship relation, physical aggression and steal. We could identified several models which were joined in three categories. Such models reflected the diversity and regularity that are present inside the elaborated reasoning to solve the conflicts shown by us. We conclude that the diversity of organizer models identified shows the importance of the contents in the construction of moral reasoning.

Avaliação in vitro do aparelho DIAGNOdent para diagnóstico oclusal

The aim of this study was to determine the effectiveness and reliability of laser fluorescence measurements in relation to occlusal caries diagnosis. DIAGNOdent 2095 (Kavo, Biberach, Germany), which has been developed especially for caries diagnosis, was utilized. Five (5) teeth were examined in the pilot test; after that, ten (10) teeth were examined in order to calibrate both examiners. Data were obtained from 66 teeth (36 molars and 30 premolars), totalizing 144 sites identified through photographs of the occlusal surfaces. Reproducibility was evaluated in 10 teeth. The interexaminer Spearman correlation (r) was 0.89 and the intra-examiner, 0.93 and 0.97 (examiner A and B, respectively). Validation was carried out by histological examination (stereomicroscope). For the two examiners the sensitivity of the device was relatively high, varying from 0.81 to 1.00, while specificity varied according to which validation criterion was used (0.77 - 0.86: enamel lesion / 0.52 - 0.59: dentin lesion). It was concluded that DIAGNodent presented good capacity of identifying any alteration of the dental surface, nevertheless it presents the disadvantage of accomplishing many false-positive diagnosis when the validation criterion is dentin lesion.

Influência da atividade física na qualidade de vida e auto-imagem de mulheres incontinentes

Our aim was to verify the influence of a physical activities proposal in the quality of life and self image of incontinent women. This study was comparative and exploratory and was developed in 16 weeks. Thirty-seven women with and without urinary incontinence (IU) participated in the study. After the study, significant improvement in general health perception (p < 0.001), UI impact (p = 0.035), physical limitations (p = 0.015), personal relations, (p = 0.048), sleep and disposition (p = 0.012) and concerned with the gravity measurements (p = 0.011) was observed. Concerning self image, alterations in appearance were not observed; however, concerning body satisfaction, the women felt less satisfied with their bodies (p = 0.007). There was a reduction in the number of regions where they felt pain (p = 0.0003) and that they did not like (p = 0.0017). In conclusion, the Physical Education professionals using a systematized and integrated physical activities program can lead the women with IU to significant improvement in the perception of their quality of life and health concerning their self image with improvement of the IU symptoms and reduction of frequency and amount of urinary loss.

O ambiente virtual de aprendizagem e sua incorporação na Unicamp

The text describes a study about the adoption of virtual learning environments and its consequences to the learning process of undergraduate students at the State University of Campinas - Unicamp. These environments can be incorporated in various ways into the academic daily life of students and teachers. One efficient way to promote the adoption of these environments, as observed by the Distance Learning support team, is to train teachers and students in their use. Two training alternatives are described in this text to instruct the academic community in the use of TelEduc, a freeware developed and coordinated by the NIED - Núcleo de Informática Aplicada à Educação (Center for Information Technology Applied to Education), and officially adopted by Unicamp. Training courses are offered in two ways - presence or distance learning - to suit each teacher's preferences. This article compares the two modes of training, showing their strong and weak points. The adoption of TelEduc and its direct consequences to the learning process are described in a study carried out with some engineering undergraduates at Unicamp. The authors' questions and the general views of teachers and students regarding the effectiveness of the use of TelEduc as a supporting tool to presence teaching are presented. This investigation revealed the importance of training teachers in the effective use of these environments.

Perfil sensorial de ovos de Páscoa

Easter egg is a popular chocolate-candy in egg form commercialized in Brazil during Easter time. In this research, Quantitative Descriptive Analysis was applied to select sensory attributes which best define the modifications in appearance, aroma, flavor and texture when cocoa butter equivalent (CBE) is added to Easter eggs. Samples with and without CBE were evaluated by a selected panel and fourteen attributes best describing similarities and differences between them, were defined. Terms definition, reference materials and a consensus ballot were developed. After a training period, panelists evaluated the samples in a Complete Block Design using a 9 cm unstructured scale. Principal Component Analysis, ANOVA and Tukey test (p<0.05) were applied to the data in order to select attributes which best discriminated and characterized the samples. Samples showed significant differences (p<0.05) in all attributes. Easter egg without CBE showed higher intensities (p<0.05) in relation to the following descriptors: brown color, characteristic aroma, cocoa mass aroma, cocoa butter aroma, characteristic flavor, cocoa mass flavor, hardness and brittleness.

Perfil sensorial de vinhos brancos varietais brasileiros através de análise descritiva quantitativa

Descriptive terminology and sensory profile of three varieties of brazilian varietal white wines (cultivars Riesling, Gewürztraminer and Chardonnay) were developed by a methodology based on the Quantitative Descriptive Analysis (QDA). The sensory panel consensually defined the sensory descriptors, their respective reference materials and the descriptive evaluation ballot. Ten individuals were selected as judges based on their discrimination, reproducibility and individual consensus with the sensory panel. Twelve descriptors were generated showing similarities and differences among the wine samples. Each descriptor was evaluated using a nine-centimeters non-structured scale with the intensity terms anchored at its ends. The collected data were analysed by ANOVA, Tukey test and Principal Component Analysis (PCA). The results showed a great difference within the sensory profile of Riesling and Gewürztraminer wines, whereas Chardonnay wines showed a lesser variation. PCA separated samples into two groups: a first group formed by wines higher in sweetness and fruitty flavor and aroma; and a second group of wines higher in sourness, adstringency, bitterness, alcoholic and fermented flavors.

Gluttonous predators: how to estimate prey size when there are too many prey

Prey size is an important factor in food consumption. In studies of feeding ecology, prey items are usually measured individually using calipers or ocular micrometers. Among amphibians and reptiles, there are species that feed on large numbers of small prey items (e.g. ants, termites). This high intake makes it difficult to estimate prey size consumed by these animals. We addressed this problem by developing and evaluating a procedure for subsampling the stomach contents of such predators in order to estimate prey size. Specifically, we developed a protocol based on a bootstrap procedure to obtain a subsample with a precision error of at the most 5%, with a confidence level of at least 95%. This guideline should reduce the sampling effort and facilitate future studies on the feeding habits of amphibians and reptiles, and also provide a means of obtaining precise estimates of prey size.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Práticas escolares e desempenho acadêmico de alunos com TDAH

This article reports the results from the research work which objects the critical and profound study about the ADHD (Attention Deficit/Hyperactivity Disorder) in the courses for teachers' development in College Education, under its various dimensions - social, cultural, pedagogical, biological. The investigation focused on five adults with diagnosis for ADHD. The methodology used was the Case Study, developed from the Oral History as a source of data. The results that were obtained suggest that the study, proposed in the research, may contribute significantly for the teachers to know determining factors of the school performance of students with this disorder, as well as to guide them in the search of partnership with other professionals - doctors and psychologists, for example - when such partnership becomes necessary.

Long-term follow-up of an 8-year-old boy with insulinoma as the first manifestation of a familial form of multiple endocrine neoplasia type 1

Multiple endocrine neoplasia type 1 (MEN1) is an autosomal dominant hereditary cancer syndrome characterized mostly by parathyroid, enteropancreatic, and anterior pituitary tumors. We present a case of an 8-year-old boy referred because of hypoglycemic attacks. His diagnosis was pancreatic insulinoma. Paternal grandmother died due to repeated gastroduodenal ulcerations and a paternal aunt presented similar manifestations. At a first evaluation, the father presented only gastric ulceration but subsequently developed hyperparathyroidism and lung carcinoid tumor. During almost 15 years of follow-up, three brothers and the index case presented hyperparathyroidism and hyperprolactinemia. Molecular study showed a G to A substitution in intron 4, at nine nucleotides upstream of the splicing acceptor site, causing a splicing mutation. All affected members of the family have the same mutation. Paternal grandmother and aunt were not studied and the mother does not carry any mutation. MEN1 is a rare condition that requires permanent medical assistance. Early clinical and genetic identification of affected individuals is essential for their own surveillance and also for genetic counseling.

Consenso brasileiro para a abordagem clínica e tratamento do hipotireoidismo subclínico em adultos: recomendações do Departamento de Tireoide da Sociedade Brasileira de Endocrinologia e Metabologia

INTRODUCTION: Subclinical hypothyroidism (SCH), defined as elevated concentrations of thyroid stimulating hormone (TSH) despite normal levels of thyroid hormones, is highly prevalent in Brazil, especially among women and the elderly. Although an increasing number of studies have related SCH to an increased risk of coronary artery disease and mortality, there have been no randomized clinical trials verifying the benefit of levothyroxine treatment in reducing these risks, and the treatment remains controversial. OBJECTIVE: This consensus, sponsored by the Thyroid Department of the Brazilian Society of Endocrinology and Metabolism and developed by Brazilian experts with extensive clinical experience with thyroid diseases, presents these recommendations based on evidence for the clinical management of SCH patients in Brazil. MATERIALS AND METHODS: After structuring the clinical questions, the search for evidence in the literature was initially performed in the MedLine-PubMed database and later in the Embase and SciELO - Lilacs databases. The strength of evidence was evaluated according to the Oxford classification system and established based on the experimental design used, considering the best available evidence for each question and the Brazilian experience. RESULTS: The topics covered included SCH definition and diagnosis, natural history, clinical significance, treatment and pregnancy, and the consensus issued 29 recommendations for the clinical management of adult patients with SCH. CONCLUSION: Treatment with levothyroxine was recommended for all patients with persistent SCH with serum TSH values > 10 mU/L and for certain patient subgroups.