Genetic diversity and epidemiology of Tobacco streak virus and related subgroup 1 Ilarviruses

A quarter of Australia’s sunflower production is from the central highlands region of Queensland and is currently worth six million dollars ($AUD) annually. From the early 2000s a severe necrosis disorder of unknown aetiology was affecting large areas of sunflower crops in central Queensland, leading to annual losses of up to 20%. Other crops such as mung bean and cotton were also affected. This PhD study was undertaken to determine if the causal agent of the necrosis disorder was of viral origin and, if so, to characterise its genetic diversity, biology and disease cycle, and to develop effective control strategies. The research described in this thesis identified Tobacco streak virus (TSV; genus Ilarvirus, family Bromoviridae) as the causal agent of the previously unidentified necrosis disorder of sunflower in central Queensland. TSV was also the cause of commonly found diseases in a range of other crops in the same region including cotton, chickpea and mung bean. This was the first report from Australia of natural field infections of TSV from these four crops. TSV strains have previously been reported from other regions of Australia in several hosts based on serological and host range studies. In order to determine the relatedness of previously reported TSV strains with TSV from central Queensland, we characterised the genetic diversity of the known TSV strains from Australia. We identified two genetically distinct TSV strains from central Queensland and named them based on their major alternative hosts, TSV-parthenium from Parthenium hysterophorus and TSV-crownbeard from Verbesina encelioides. They share only 81 % total-genome nucleotide sequence identity. In addition to TSV-parthenium and TSV-crownbeard from central Queensland, we also described the complete genomes of two other ilarvirus species. This proved that previously reported TSV strains, TSV-S isolated from strawberry and TSV-Ag from Ageratum houstonianum, were actually the first record of Strawberry necrotic shock virus from Australia, and a new subgroup 1 ilarvirus, Ageratum latent virus. Our results confirmed that the TSV strains found in central Queensland were not related to previously described strains from Australia and may represent new incursions. This is the first report of the genetic diversity within subgroup 1 ilarviruses from Australia. Based on field observations we hypothesised that parthenium and crownbeard were acting as symptomless hosts of TSV-parthenium and TSV-crownbeard, respectively. We developed strain-specific multiplex PCRs for the three RNA segments to accurately characterise the range of naturally infected hosts across central Queensland. Results described in this thesis show compelling evidence that parthenium and crownbeard are the major (symptomless) alternative hosts of TSV-parthenium and TSV-crownbeard. While both TSV strains had wide natural host ranges, the geographical distribution of each strain was closely associated with the respective distribution of their major alternative hosts. Both TSV strains were commonly found across large areas of central Queensland, but we only found strong evidence for the TSV-parthenium strain being associated with major disease outbreaks in nearby crops. The findings from this study demonstrate that both TSV-parthenium and TSV-crownbeard have similar life cycles but some critical differences. We found both TSV strains to be highly seed transmitted from their respective major alternative hosts from naturally infected mother plants and survived in seed for more than 2 years. We conclusively demonstrated that both TSV strains were readily transmitted via virus-infected pollen taken from the major alternative hosts. This transmission was facilitated by the most commonly collected thrips species, Frankliniella schultzei and Microcephalothrips abdominalis. These results illustrate the importance of seed transmission and efficient thrips vector species for the effective survival of these TSV strains in an often harsh environment and enables the rapid development of TSV disease epidemics in surrounding crops. Results from field surveys and inoculation tests indicate that parthenium is a poor host of TSV-crownbeard. By contrast, crownbeard was naturally infected by, and an experimental host of TSV-parthenium. However, this infection combination resulted in non-viable crownbeard seed. These differences appear to be an effective biological barrier that largely restricts these two TSV strains to their respective major alternative hosts. Based on our field observations we hypothesised that there were differences in relative tolerance to TSV infection between different sunflower hybrids and that seasonal variation in disease levels was related to rainfall in the critical early crop stage. Results from our field trials conducted over multiple years conclusively demonstrated significant differences in tolerance to natural infections of TSV-parthenium in a wide range of sunflower hybrids. Glasshouse tests indicate the resistance to TSV-parthenium identified in the sunflower hybrids is also likely to be effective against TSV-crownbeard. We found a significant negative association between TSV disease incidence in sunflowers and accumulated rainfall in the months of March and April with increasing rainfall resulting in reduced levels of disease. Our results indicate that the use of tolerant sunflower germplasm will be a critical strategy to minimise the risk of TSV epidemics in sunflower.

The business of myth-making: Mary Poppins, P.L. Travers and the Disney effect

In just one of the many extraordinary moments during the spectacular Opening Ceremony of the 2012 London Olympic Games, thirty Mary Poppinses floated into the stadium on their umbrellas to battle a 40 foot-long inflatable Lord Voldemort. This multi-million pound extravaganza was telecast to a global audience of over one billion people, highlighting in an extremely effective manner the grandeur and eccentricities of the host nation, and featuring uniquely British icons such as Mr Bean, James Bond, The Beatles and Harry Potter, as well as those quintessential icons of Englishness, the Royal Family, double-decker red buses and the National Health Service.

Valence and spatial explanations for voting in the 2013 Australian election

This paper examines the 2013 Australian federal election to test two competing models of vote choice: spatial politics and valence issues. Using data from the 2013 Australian Election Study, the analysis finds that spatial politics (measured by party identification and self-placement on the left-right spectrum) and valence issues both have significant effects on vote choice. However, spatial measures are more important than valence issues in explaining vote choice, in contrast with recent studies from Britain, Canada and the United States. Explanations for these differences are speculative, but may relate to Australia’s stable party and electoral system, including compulsory voting and the frequency of elections. The consequently high information burden faced by Australian voters may lead to a greater reliance on spatial heuristics than is found elsewhere.

Oxidation of thiones by singlet and triplet oxygen

Molecular oxygen (012) i8 eatabliehed to be a good electrophile' and haabean Pound to yield many interesting moleculae upon reaction with olefinic, aromatic and other mu1 tipla bonded compounda. Although, oxidation of carbon ulphur double bond (thiones) by air her bean know for a longtime, nai the r the aechaniam nor the reactive species involved in theae oxidationa have bean etabliahodo Although there is no clear experimental verification, involvement of malecular oxygen in such types of oxidationa oP activated thiocarbonyl coc pounds has been recently auggeetad.4.

Documenting the inevitable: Voting behaviour at the 2013 Australian election

This chapter uses data from the 2013 Australian Election Study (AES), conducted by Clive Bean, Ian McAllister, Juliet Pietsch and Rachel Gibson (Bean et al. 2014) to investigate political attitudes and voting behaviour in the election. The study was funded by the Australian Research Council and involved a national survey of political attitudes and behaviour using a self-completion questionnaire mailed to respondents on the day before the 7 September election. The sample was a systematic random sample of enrolled voters throughout Australia, drawn by the Australian Electoral Commission. Respondents were given the option of returning the completed questionnaire by reply-paid mail or completing the survey online. Non-respondents were sent several follow-up mailings and the final sample size was 3955, representing a response rate of 34 per cent. The data were weighted to reflect population parameters for gender, age, state and vote.

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

Structure of Sesbania mosaic virus at 3 angstrom resolution

Sesbania mosaic virus (SMV) is an isometric, ss-RNA plant virus found infecting Sesbania grandiflora plants in fields near Tirupathi, South India. The virus particles, which sediment at 116 S at pH 5.5, swell upon treatment with EDTA at pH 7.5 resulting in the reduction of the sedimentation coefficient to 108 S. SMV coat protein amino acid sequence was determined and found to have approximately 60% amino acid sequence identity with that of southern bean mosaic virus (SBMV). The amino terminal 60 residue segment, which contains a number of positively charged residues, is less well conserved between SMV and SBMV when compared to the rest of the sequence. The 3D structure of SMV was determined at 3.0 Å resolution by molecular replacement techniques using SBMV structure as the initial phasing model. The icosahedral asymmetric unit was found to contain four calcium ions occurring in inter subunit interfaces and three protein subunits, designated A, B and C. The conformation of the C subunit appears to be different from those of A and B in several segments of the polypeptide. These observations coupled with structural studies on SMV partially depleted of calcium suggest a plausible mechanisms for the initiation of the disassembly of the virus capsid.

Type III Secretion System of Phytopathogenic Bacterium Pseudomonas syringae:From Gene to Function

The type III secretion system (T3SS) is an essential requirement for the virulence of many Gram-negative bacteria which infect plants, animals and men. Pathogens use the T3SS to deliver effector proteins from the bacterial cytoplasm to the eukaryotic host cells, where the effectors subvert host defenses. The best candidates for directing effector protein traffic are the bacterial type III-associated appendages, called needles or pili. In plant pathogenic bacteria, the best characterized example of a T3SS-associated appendage is the HrpA pilus of the plant pathogen Pseudomonas syringae pv. tomato DC3000. The components of the T3SS in plant pathogens are encoded by a cluster of hrp (hypersensitive reaction and pathogenicity) genes. Two major classes of T3SS-secreted proteins are: harpin proteins such as HrpZ which are exported into extracellular space, and avirulence (Avr) proteins such as AvrPto which are translocated directly to the plant cytoplasm. This study deals with the structural and functional characterization of the T3SS-associated HrpA pilus and the T3SS-secreted harpins. By insertional mutagenesis analysis of HrpA, we located the optimal epitope insertion site in the amino-terminus of HrpA, and revealed the potential application of the HrpA pilus as a carrier of antigenic determinants for vaccination. By pulse-expression of proteins combined with immuno-electron microscopy, we discovered the Hrp pilus assembly strategy as addition of HrpA subunits to the distal end of the growing pilus, and we showed for the first time that secretion of HrpZ occurs at the tip of the pilus. The pilus thus functions as a conduit delivering proteins to the extracellular milieu. By using phage-display and scanning-insertion mutagenesis methods we identified a conserved HrpZ-binding peptide and localized the peptide-binding site to the central domain of HrpZ. We also found that the HrpZ specifically interacts with a host bean protein. Taken together, the current results provide deeper insight into the molecular mechanism of T3SS-associated pilus assembly and effector protein translocation, which will be helpful for further studies on the pathogenic mechanisms of Gram-negative bacteria and for developing new strategies to prevent bacterial infection.

Potential antioxidant response to coffee - A matter of genotype?

In a human intervention trial, a coffee, combining nature green coffee bean constituents and dark roast products was studied towards its potential to activate the Nrf2/ARE-pathway in PBLs. The study coffee was identified as a strong inducer of Nrf2 and downstream GST1A1 and UGT1A1 gene transcription. However, the response of the participants was found to depend on the respective genotype. The -651 SNP in the Nrf2 gene as well as the heterozygote 6/7 sequence in the UGT1A1 gene significantly down-regulated the susceptibility to respond to coffee, proposing the existing genotype to be critical for the response to the coffee.

Cucumber chloroplast trnL(CAA) gene: nucleotide sequence and in vivo expression analysis in etiolated cucumber seedlings treated with benzyladenine and light.

The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA-treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had no detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These data indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.

Cucumber chloroplast trnL(CAA) gene: nucleotide sequence and in vivo expression analysis in etiolated cucumber seedlings treated with benzyladenine and light

The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA- treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had not detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These date indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.

Variations in the Levels of Chloroplast tRNAs and Aminoacyl-tRNA Synthetases in Senescing Leaves of Phaseolus vulgaris

The relative amounts of chloroplast tRNAs(Leu), tRNA(Glu), tRNA(Phe), tRNAs(Thr), and tRNA(Tyr) and of chloroplastic and cytoplasmic aminoacyl-tRNA synthetases were compared in green leaves, yellowing senescing leaves, and N(6)-benzyladenine-treated senescing leaves from bean (Phaseolus vulgaris, var Contender). Aminoacylation of the tRNAs using Escherichia coli aminoacyl-tRNA synthetases indicated that in senescing leaves the relative amount of chloroplast tRNA(Phe) was significantly lower than in green leaves. Senescing leaves treated with N(6)-benzyladenine contained higher levels of this tRNA than untreated senescing leaves. No significant change in the relative amounts of chloroplast tRNAs(Leu), tRNAs(Thr), and tRNA(Tyr) was detected in green, yellow senescing, or N(6)-benzyladine-treated senescing leaves. Relative levels of chloroplast tRNAs were also estimated by hybridization of tRNAs to DNA blots of gene specific probes. These experiments confirmed the results obtained by aminoacylation and revealed in addition that the relative level of chloroplast tRNA(Glu) is higher in senescing leaves than in green leaves. Transcription run-on assays indicated that these changes in tRNA levels are likely to be due to a differential rate of degradation rather than to a differential rate of transcription of the tRNA genes. Chloroplastic and cytoplasmic leucyl-, phenylalanyl-, and tyrosyl-tRNA synthetase activities were greatly reduced in senescing leaves as compared to green leaves, whereas N(6)-benzyladenine-treated senescing leaves contained higher enzyme activities than untreated senescing leaves. These results suggest that during senescence, as well as during senescence-retardation by cytokinins, changes in enzyme activities, such as aminoacyl-tRNA synthetases, rather than reduced levels of tRNAs, affect the translational capacity of chloroplasts.

Facile one-pot synthesis of thio and selenourea derivatives: A new class of potent urease inhibitors

A facile, one-pot synthesis of thio and selenourea derivatives from amines using tetrathiomolybdate 1 and tetraseleno-tungstate 2 as sulfur and selenium transfer reagents, respectively, is reported. The compounds were tested for their activity as urease inhibitors and some of the compounds showed potent activity in the nanomolar range towards jack bean urease. (C) 2007 Elsevier Ltd. All rights reserved.

Conformationally locked thiosugars alpha-mannosidase inhibitors: Synthesis, and docking studies as potent biochemical

series of thiosugar derivatives (thiolevomannosans) derived from mannose were synthesized and their inhibitory activity was tested against alpha-mannosidase (jack bean). These inhibitors were found to be more potent than the well-known inhibitors like kifunensine and deoxymannojirimycin based on docking and biochemical studies. The sulfone derivative 10 was shown to be the best inhibitor of alpha-mannosidase with the K-i value of 350 nM. (c) 2007 Elsevier Ltd. All rights reserved.

Studies on the interaction of concanavalin A with glycoproteins

Lectins (phytohaemagglutinin) are known to have the unique property of binding with certain specific sugars, polysaccharides and glycoproteins. Although the kinetics of interaction between lectins and sugar have been extensively studied, the binding characteristics of the lectins with various glycoproteins are not well understood. In this laboratory a systematic study has been initiated in relation to the interaction of lectins with glycoproteins. Concanavalin A is known to bind alpha-glucosides, mannosides and biopolymers having these sugar configurations. A galactose binding protein from caster bean has been purified to homogeneity and was found to contain mannose. This lectin was used as the source of glycoprotein for studying its interaction with concanavalin A. This study showed that the interaction is temperature dependent and the dissociation is time and alpha-methyl glucoside concentration dependent. This has led to speculate a model for cell-lectin interaction. Using concanavalin A it has been shown that all the lysosomal enzymes from brain studied were glycoprotein in nature. Moreover, using Sepharose-bound concanavalin A it has been possible to devise a method by which these lysosomal enzymes could be purified considerably. With the knowledge that the interaction between lectin and glycoprotein is not only dependent on the specific sugar present in the glycoprotein, but also on the nature of the glycoprotein it was possible to develop a novel method for immobilizing various glycoprotein enzymes, such as arylsulphatase A, hyaluronidase and glucose oxidase.