Seed dispersal of Solanum thomasiifolium Sendtner (Solanaceae) in the Linhares Forest, Espírito Santo state, Brazil

The aim of this study was to analyse seed dispersal and establishment of Solanum thomasiifolium in an area of nativo vegetation in Espirito Santo state on the southeastern Brazilian coast. Ten species of birds, the crab-eating fox (Cerdocyon thous), and one species of lizard (Tropidurus torquatus) fed on S. thomasiifolium fruits and dispersed viable seeds in their faeces. The proportional contribution of each of these groups to seed dispersal was 77% (birds), 19% (crab-eating fox) and 4% (lizards). Ants also contributed to seed dispersal. More seeds were deposited in vegetation islands than in the surrounding open areas. Germination rates of seeds collected directly from fruit (control), bird droppings, the faeces of crab-eating foxes and lizards were, respectively, 64, 64, 53, and 80 %. Differences among these rates were all significant, except between birds and control. Lizards were important as seed carriers between nearby islands and they expelled a higher proportion of viable seeds. Birds and the crab-eating foxes did not enhance seed germination, but promoted seed dispersal over a wider area. Plant architecture, fruit productivity, fruit characteristics and the diversity of frugivores are important for the success of S. thomasiifolium in habitat colonization.

Is size structure a good measure of future trends of plant populations? an empirical approach using five woody species from the Cerrado (Brazilian savanna)

Size distributions in woody plant populations have been used to assess their regeneration status, assuming that size structures with reverse-J shapes represent stable populations. We present an empirical approach of this issue using five woody species from the Cerrado. Considering count data for all plants of these five species over a 12-year period, we analyzed size distribution by: a) plotting frequency distributions and their adjustment to the negative exponential curve and b) calculating the Gini coefficient. To look for a relationship between size structure and future trends, we considered the size structures from the first census year. We analyzed changes in number over time and performed a simple population viability analysis, which gives the mean population growth rate, its variance and the probability of extinction in a given time period. Frequency distributions and the Gini coefficient were not able to predict future trends in population numbers. We recommend that managers should not use measures of size structure as a basis for management decisions without applying more appropriate demographic studies.

Mixed rain forest in southeastern Brazil: tree species regeneration and floristic relationships in a remaining stretch of forest near the city of Itaberá, Brazil

The aim of this work was to evaluate the floristic composition, richness, and diversity of the upper and lower strata of a stretch of mixed rain forest near the city of Itaberá, in southeastern Brazil. We also investigated the differences between this conservation area and other stretches of mixed rain forest in southern and southeastern Brazil, as well as other nearby forest formations, in terms of their floristic relationships. For our survey of the upper stratum (diameter at breast height [DBH] > 15 cm), we established 50 permanent plots of 10 × 20 m. Within each of those plots, we designated five, randomly located, 1 × 1 m subplots, in order to survey the lower stratum (total height > 30 cm and DBH < 15 cm). In the upper stratum, we sampled 1429 trees and shrubs, belonging to 134 species, 93 genera, and 47 families. In the lower stratum, we sampled 758 trees and shrubs, belonging to 93 species, 66 genera, and 39 families. In our floristic and phytosociological surveys, we recorded 177 species, belonging to 106 genera and 52 families. The Shannon Diversity Index was 4.12 and 3.5 for the upper and lower strata, respectively. Cluster analysis indicated that nearby forest formations had the strongest floristic influence on the study area, which was therefore distinct from other mixed rain forests in southern Brazil and in the Serra da Mantiqueira mountain range.

Two mistletoes are too many?: Interspecific occurrence of mistletoes on the same host tree

Mistletoe can have a major impact on the fitness of the host plant. If there is more than one species of mistletoe on the same host tree, the overall impact might be amplified. We report the occurrence of more than one species of mistletoe on the same host tree. Although it is not a rule in the field, to our knowledge, there have been no studies of this topic. In most cases, two species of mistletoe were recorded on the same host tree, although we recorded three species of mistletoe on one occasion. This demonstrates that different species of mistletoe can be compatible with the same host species. Therefore, compatibility (structural and physiological) might be an important factor for the occurrence of mistletoe. Recent studies have shown that if the mistletoe does not recognize the host species, the deposited seeds will germinate but the haustorium will not penetrate the host branch. This is probably the primary mechanism in the establishment of more than one species of mistletoe on the same host, which can trigger a cascade of harmful effects for the host species.

Seed rain in areas with and without bamboo dominance within an urban fragment of the Atlantic Forest

Understanding the flow of diaspores is fundamental for determining plant population dynamics in a particular habitat, and a lack of seeds is a limiting factor in forest regeneration, especially in isolated forest fragments. Bamboo dominance affects forest structure and dynamics by suppressing or delaying the recruitment of and colonization by tree species as well as by inhibiting the survival and growth of adult trees. The goal of the present study was to determine whether dominance of the bamboo species Aulonemia aristulata (Döll) McClure in the forest understory influences species abundance and composition. We examined the seed rain at two noncontiguous sites (1.5 km apart) within an urban forest fragment, with and without bamboo dominance (BD+ and BD- areas, respectively). Sixty seed traps (0.5 m², with a 1-mm mesh) were set in the BD+ and BD- areas, and the seed rain was sampled from January to December 2007. Diaspores were classified according to dispersal syndrome, growth form and functional type of the species to which they belonged. There were significant differences between the two areas in terms of seed density, species diversity and dispersal syndrome. The BD+ area showed greater seed density and species diversity. In both areas, seed distribution was limited primarily by impaired dispersal. Bamboo dominance and low tree density resulted in fewer propagules in the seed rain. Our results suggest that low availability of seeds in the rain does not promote the maintenance of a degraded state, characterized by the presence of bamboo.

Structure of the understory community in four stretches of Araucaria forest in the state of São Paulo, Brazil

We analyzed the structure of the understory community in the Atlantic Forest sensu lato, for which phytosociological descriptions of the understory are lacking. We delineated 50 plots of 10 × 20 m each at four sites within an Araucaria forest (a subtype of Atlantic Forest), located in the municipalities of Bananal, Campos do Jordão, Itaberá and Barra do Chapéu, all of which are in the state of São Paulo, Brazil. To sample the resident species of the understory, we randomly selected five 1 × 1 m subplots within each plot, resulting in a total sampling area of 250 m² at each site. We identified differences among the locations, mostly due to proportional differences in growth forms, in terms of species richness and the importance values within the community. Factors potentially influencing the understory structure include macroclimatic and microclimatic conditions, as well as forest fragmentation, the abundance of deciduous trees in the canopy, the surrounding vegetation and geographic location.

English and the discourses of colonialism

415

Performativity and the claims of scientificity of modern linguistics

This paper discusses the claim of the situatedness of research in both theoretical and applied linguistics and some of its implications and argues that it is linked to the performativity of all assertions, including scientific ones. More importantly, I argue that it is the regressive infinity of performativity that makes inevitable the passage from presumably 'dispassionate' research to militancy.

Thermolysed and active yeast to reduce the toxicity of aflatoxin

Aflatoxins are hepatotoxic metabolites produced by Aspergillus flavus and A. parasiticus on a number of agricultural commodities. This research was carried out to evaluate the ability of thermolysed and active Saccharomyces cerevisiae to attenuate liver damage caused by aflatoxin. Diets were prepared containing 0 aflatoxin; 400 mug kg-1 aflatoxin; 400 mug kg-1 aflatoxin plus 1% of dehydrated active yeast, and 400 mug kg-1 aflatoxin plus 1% of thermolysed yeast. A bioassay with Wistar rats was conducted for 28 days, and body organs were weighted and analyses of the liver tissue of the animals were performed. The relative weight of heart, kidneys and liver from animals submitted to the different treatments did not show any difference, and liver tissue of animals feeding on the aflatoxin-free diet was adopted as a toxicity-free pattern. Hepatic tissue of animals feeding on diets containing 400 mug kg-1 aflatoxin or the diet supplemented with 1% thermolysed yeast showed clear signs of toxicity and damage. Hepatic tissue of animals feeding on the diet containing 1% of dehydrated active yeast showed less toxicity signs and damage than those receiving the diet containing 400 mug kg-1 aflatoxin. Active, dehydrated yeast had the ability to reduce toxic effects caused by aflatoxin, but thermolysed yeast was not able to alleviate the effects of aflatoxin toxicity.

Evaluation of the performance of different plastics used to seal nylon cDNA arrays

cDNA arrays are a powerful tool for discovering gene expression patterns. Nylon arrays have the advantage that they can be re-used several times. A key issue in high throughput gene expression analysis is sensitivity. In the case of nylon arrays, signal detection can be affected by the plastic bags used to keep membranes humid. In this study, we evaluated the effect of five types of plastics on the radioactive transmittance, number of genes with a signal above the background, and data variability. A polyethylene plastic bag 69 μm thick had a strong shielding effect that blocked 68.7% of the radioactive signal. The shielding effect on transmittance decreased the number of detected genes and increased the data variability. Other plastics which were thinner gave better results. Although plastics made from polyvinylidene chloride, polyvinyl chloride (both 13 μm thick) and polyethylene (29 and 7 μm thick) showed different levels of transmittance, they all gave similarly good performances. Polyvinylidene chloride and polyethylene 29 mm thick were the plastics of choice because of their easy handling. For other types of plastics, it is advisable to run a simple check on their performance in order to obtain the maximum information from nylon cDNA arrays.

Evaluation of the cytotoxic and genotoxic potential of water from the River Paraíba do Sul, in Brazil, with the Allium cepa L. test

This work investigated the cytotoxic and genotoxic potential of water from the River Paraíba do Sul (Brazil) using Allium cepa roots. An anatomo-morphological parameter (root length), mitotic indices, and frequency of micronuclei were analysed. Eight bulbs were chosen at random for treatment for 24 to 120 hours with the River water collected in the years of 2005 and 2006 from sites in the cities of Tremembé and Aparecida (São Paulo state, Brazil). Daily measurements of the length of the roots grown from each bulb were carried out throughout the experiment. Mitotic index (MI) and frequency of micronuclei (MN) were determined for 2000 cells per root, using 3-5 root tips from other bulbs (7-10). Only in the roots treated with samples of the River water collected in 2005 in Tremembé city was there a decrease in the root length growth compared to the respective control. However, a reduction in MI values was verified for both sites analysed for that year. Considering the data involving root length growth and especially MI values, a cytotoxic potential is suggested for the water of the River Paraíba do Sul at Tremembé and Aparecida, in the year of 2005. On the other hand, since in this year the MN frequency was not affected with the river water treatments, genotoxicity is not assumed for the river water sampled at the aforementioned places.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Rootstocks induce contrasting photosynthetic responses of orange plants to low night temperature without affecting the antioxidant metabolism

Low temperatures negatively impact the metabolism of orange trees, and the extent of damage can be influenced by the rootstock. We evaluated the effects of low nocturnal temperatures on Valencia orange scions grafted on Rangpur lime or Swingle citrumelo rootstocks. We exposed six-month-old plants to night temperatures of 20ºC and 8ºC under controlled conditions. After decreasing the temperature to 8ºC, there were decreases in leaf CO2 assimilation, stomatal conductance, mesophyll conductance and CO2 concentration in the chloroplasts, in plant hydraulic conductivity and in the maximum electron transport rate driven ribulose-1,5-bisphosphate (RuBP) regeneration in plants grafted on both rootstocks. However, the effects of low night temperature were more severe in plants grafted on Rangpur rootstock, which also presented reduction in the maximum rate of RuBP carboxylation and in the maximum quantum efficiency of the PSII. In general, irreversible damage due to night chilling was found in the photosynthetic apparatus of plants grafted on Rangpur lime. Low night temperatures induced similar changes in the antioxidant metabolism, preventing oxidative damage in citrus leaves on both rootstocks. As photosynthesis is linked to plant growth, our findings indicate that the rootstock may improve the performance of citrus trees in environments with low night temperatures, with Swingle rootstock improving the photosynthetic acclimation in leaves of orange plants.

Unusual branching in the palm Euterpe edulis Mart

The unusual development of branches along the stem of Euterpe edulis is described for the first time. Branches originated at 2 to 190 cm from the ground. Ramified individuals and branches were able to produce reproductive structures and some branches produced roots. A plausible cause for the observed anomaly could be genetic problems due to small population sizes. The better agreement of this process can have a positive effect in the harvest of the heart of palm through the artificial induction of sprouts, what would prevent the death of the individual.

Atypical antipsychotics in the treatment of pathological aggression in children and adolescents: literature review and clinical recommendations

Objective: To review the literature about the use of atypical antipsychotics in the treatment of pathological aggression in children and adolescents. Method: The databases MEDLINE, SciELO, and LILACS were searched for publications in Portuguese or English from 1992 to August 2011 using the following keywords: mental disease, child, adolescent, treatment, atypical antipsychotic, aggressive behavior, aggression, and violent behavior. Results: Sixty-seven studies of good methodological quality and clinical interest and relevance were identified. Studies including children and adolescents were relatively limited, because few atypical antipsychotics have been approved by the Food and Drug Administration (FDA). All the medications included in this review (risperidone, olanzapine, quetiapine, ziprasidone, aripiprazole and clozapine) have some effectiveness in treating aggression in children and adolescents, and choices should be based on clinical indications and side effects. Conclusions: There are few studies about the effectiveness and safety of atypical antipsychotics for the pediatric population, and further randomized controlled studies with larger groups of patients and more diagnostic categories, such as severe conduct disorder and oppositional defiant disorder, should be conducted to confirm the results reported up to date and to evaluate the impact of long-term use.