954 resultados para Dignity of the human being


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Elucidating the relevant genomic changes mediating development and evolution of prostate cancer is paramount for effective diagnosis and therapy. A putative dominant-acting nude mouse prostatic carcinoma tumor-inducing gene, PTI-1, has been cloned that is expressed in patient-derived human prostatic carcinomas but not in benign prostatic hypertrophy or normal prostate tissue. PTI-1 was detected by cotransfecting human prostate carcinoma DNA into CREF-Trans 6 cells, inducing tumors in nude mice, and isolating genes displaying increased expression in tumor-derived cells by using differential RNA display (DD). Screening a human prostatic carcinoma (LNCaP) cDNA library with a 214-bp DNA fragment found by DD permitted the cloning of a full-length 2.0-kb PTI-1 cDNA. Sequence analysis indicates that PTI-1 is a gene containing a 630-bp 5' sequence and a 3' sequence homologous to a truncated and mutated form of human elongation factor 1 alpha. In vitro translation demonstrates that the PTI-1 cDNA encodes a predominant approximately 46-kDa protein. Probing Northern blots with a DNA fragment corresponding to the 5' region of PTI-1 identifies multiple PTI-1 transcripts in RNAs from human carcinoma cell lines derived from the prostate, lung, breast, and colon. In contrast, PTI-1 RNA is not detected in human melanoma, neuroblastoma, osteosarcoma, normal cerebellum, or glioblastoma multiforme cell lines. By using a pair of primers recognizing a 280-bp region within the 630-bp 5' PTI-1 sequence, reverse transcription-PCR detects PTI-1 expression in patient-derived prostate carcinomas but not in normal prostate or benign hypertrophic prostate tissue. In contrast, reverse transcription-PCR detects prostate-specific antigen expression in all of the prostate tissues. These results indicate that PTI-1 may be a member of a class of oncogenes that could affect protein translation and contribute to carcinoma development in human prostate and other tissues. The approaches used, rapid expression cloning with the CREF-Trans 6 system and the DD strategy, should prove widely applicable for identifying and cloning additional human oncogenes.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Heme oxygenase (HO) is a stress protein and has been suggested to participate in defense mechanisms against agents that may induce oxidative injury such as metals, endotoxin, heme/hemoglobin, and various cytokines. Overexpression of HO in cells might therefore protect against oxidative stress produced by certain of these agents, specifically heme and hemoglobin, by catalyzing their degradation to bilirubin, which itself has antioxidant properties. We report here the successful in vitro transfection of rabbit coronary microvessel endothelial cells with a functioning gene encoding the human HO enzyme. A plasmid containing the cytomegalovirus promoter and the human HO cDNA complexed to cationic liposomes (Lipofectin) was used to transfect rabbit endothelial cells. Cells transfected with human HO exhibited an approximately 3.0-fold increase in enzyme activity and expressed a severalfold induction of human HO mRNA as compared with endogenous rabbit HO mRNA. Transfected and nontransfected cells expressed factor VIII antigen and exhibited similar acetylated low-density lipoprotein uptake (two important features that characterize endothelial cells) with > 85% of cells staining positive for each marker. Moreover, cells transfected with the human HO gene acquired substantial resistance to toxicity produced by exposure to recombinant hemoglobin and heme as compared with nontransfected cells. The protective effect of HO overexpression against heme/hemoglobin toxicity in endothelial cells shown in these studies provides direct evidence that the inductive response of human HO to such injurious stimuli represents an important tissue adaptive mechanism for moderating the severity of cell damage produced by these blood components.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Many human malignant cells lack methylthioadenosine phosphorylase (MTAP) enzyme activity. The gene (MTAP) encoding this enzyme was previously mapped to the short arm of chromosome 9, band p21-22, a region that is frequently deleted in multiple tumor types. To clone candidate tumor suppressor genes from the deleted region on 9p21-22, we have constructed a long-range physical map of 2.8 megabases for 9p21 by using overlapping yeast artificial chromosome and cosmid clones. This map includes the type IIFN gene cluster, the recently identified candidate tumor suppressor genes CDKN2 (p16INK4A) and CDKN2B (p15INK4B), and several CpG islands. In addition, we have identified other transcription units within the yeast artificial chromosome contig. Sequence analysis of a 2.5-kb cDNA clone isolated from a CpG island that maps between the IFN genes and CDKN2 reveals a predicted open reading frame of 283 amino acids followed by 1302 nucleotides of 3' untranslated sequence. This gene is evolutionarily conserved and shows significant amino acid homologies to mouse and human purine nucleoside phosphorylases and to a hypothetical 25.8-kDa protein in the pet gene (coding for cytochrome bc1 complex) region of Rhodospirillum rubrum. The location, expression pattern, and nucleotide sequence of this gene suggest that it codes for the MTAP enzyme.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Regional cerebral blood flow was measured with positron emission tomography during the performance of a verbal free recall task, a verbal paired associate task, and tasks that required the production of verbal responses either by speaking or writing. Examination of the differences in regional cerebral blood flow between these conditions demonstrated that the left ventrolateral frontal cortical area 45 is involved in the recall of verbal information from long-term memory, in addition to its contribution to speech. The act of writing activated a network of areas involving posterior parietal cortex and sensorimotor areas but not ventrolateral frontal cortex.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The adrenoleukodystrophy protein (ALDp) is an ATP-binding cassette (ABC) transporter in the human peroxisome membrane. It is defective in X chromosome-linked adrenoleukodystrophy (ALD), a neurodegenerative disorder with impaired peroxisomal oxidation of very long chain fatty acids. We report cloning and characterization of PXA1, a yeast gene encoding a protein (Pxa1p) exhibiting high similarity to ALDp. Disruption of PXA1 results in impaired growth on oleic acid and reduced ability to oxidize oleate. Pxa1p is peroxisome associated; however, in the PXA1 mutant yeast, as in ALD cells, peroxisomes are morphologically intact. Disruption of a second yeast gene, YKL741, which encodes a more distantly related ALDp homolog (Yk174p), in either wild-type or PXA1 mutant yeast, results in a growth phenotype identical to that of the PXA1 mutant. This result suggests that Yk1741p and Pxa1p may be subunits of the same transporter. Sequence analysis of Pxa1p, ALDp, and related ABC transporters reveals a possible fatty acid binding domain and a 14-amino acid EAA-like motif, previously described only in prokaryotes. Because of the similarities in sequence and function, we propose that Pxa1p is the Saccharomyces cerevisiae ortholog of ALDp.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

We used a bacterially expressed fusion protein containing the entire cytoplasmic domain of the human leukemia inhibitory factor (LIF) receptor to study its phosphorylation in response to LIF stimulation. The dose- and time-dependent relationships for phosphorylation of this construct in extracts of LIF-stimulated 3T3-L1 cells were superimposable with those for the stimulation of mitogen-activated protein kinase (MAPK). Indeed, phosphorylation of the cytoplasmic domain of the low-affinity LIF receptor alpha-subunit (LIFR) in Mono Q-fractionated, LIF-stimulated 3T3-L1 extracts occurred only in those fractions containing activated MAPK; Ser-1044 served as the major phosphorylation site in the human LIFR for MAPK both in agonist-stimulated 3T3-L1 lysates and by recombinant extracellular signal-regulated kinase 2 in vitro. Expression in rat H-35 hepatoma cells of LIFR or chimeric granulocyte-colony-stimulating factor receptor (G-CSFR)-LIFR mutants lacking Ser-1044 failed to affect cytokine-stimulated expression of a reporter gene under the control of the beta-fibrinogen gene promoter but eliminated the insulin-induced attenuation of cytokine-stimulated gene expression. Thus, our results identify the human LIFR as a substrate for MAPK and suggest a mechanism of heterologous receptor regulation of LIFR signaling occurring at Ser-1044.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Successful gene transfer into stem cells would provide a potentially useful therapeutic modality for treatment of inherited and acquired disorders affecting hematopoietic tissues. Coculture of primate bone marrow cells with retroviral producer cells, autologous stroma, or an engineered stromal cell line expressing human stem cell factor has resulted in a low efficiency of gene transfer as reflected by the presence of 0.1-5% of genetically modified cells in the blood of reconstituted animals. Our experiments in a nonhuman primate model were designed to explore various transduction protocols that did not involve coculture in an effort to define clinically useful conditions and to enhance transduction efficiency of repopulating cells. We report the presence of genetically modified cells at levels ranging from 0.1% (granulocytes) to 14% (B lymphocytes) more than 1 year following reconstitution of myeloablated animals with CD34+ immunoselected cells transduced in suspension culture with cytokines for 4 days with a retrovirus containing the glucocerebrosidase gene. A period of prestimulation for 7 days in the presence of autologous stroma separated from the CD34+ cells by a porous membrane did not appear to enhance transduction efficiency. Infusion of transduced CD34+ cells into animals without myeloablation resulted in only transient appearance of genetically modified cells in peripheral blood. Our results document that retroviral transduction of primate repopulating cells can be achieved without coculture with stroma or producer cells and that the proportion of genetically modified cells may be highest in the B-lymphoid lineage under the given transduction conditions.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Expression of the 70-kDa polypeptide of human Ku autoantigen in rat cells is shown to suppress specifically the induction of hsp70 upon heat shock. Thermal induction of other heat shock proteins is not significantly affected, nor is the state of phosphorylation or the DNA-binding ability of the heat shock transcription factor HSF1. These findings support a model in which hsp70 gene expression is controlled by a second regulatory factor in addition to the positive activator HSF1. The Ku autoantigen, or a protein closely related to it, is likely to be involved in the regulation of hsp70 expression.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The squamous cell carcinoma antigen (SCCA) is a member of the ovalbumin family of serine proteinase inhibitors (serpins). A neutral form of the protein is found in normal and some malignant squamous cells, whereas an acidic form is detected exclusively in tumor cells and in the circulation of patients with squamous cell tumors. In this report, we describe the cloning of the SCCA gene from normal genomic DNA. Surprisingly, two genes were found. They were tandemly arrayed and flanked by two other closely related serpins, plasminogen activator inhibitor type 2 (PAI2) and maspin at 18q21.3. The genomic structure of the two genes, SCCA1 and SCCA2, was highly conserved. The predicted amino acid sequences were 92% identical and suggested that the neutral form of the protein was encoded by SCCA1 and the acidic form was encoded by SCCA2. Further characterization of the region should determine whether the differential expression of the SCCA genes plays a causal role in development of more aggressive squamous cell carcinomas.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This paper presents a model of a control system for robot systems inspired by the functionality and organisation of human neuroregulatory system. Our model was specified using software agents within a formal framework and implemented through Web Services. This approach allows the implementation of the control logic of a robot system with relative ease, in an incremental way, using the addition of new control centres to the system as its behaviour is observed or needs to be detailed with greater precision, without the need to modify existing functionality. The tests performed verify that the proposed model has the general characteristics of biological systems together with the desirable features of software, such as robustness, flexibility, reuse and decoupling.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Human tremor can be defined as a somewhat rhythmic and quick movement of one or more body parts. In some people, it is a symptom of a neurological disorder. From the mathematical point of view, human tremor can be defined as a weighted contribution of different sinusoidal signals which causes oscillations of some parts of the body. This sinusoidal is repeated over time, but its amplitude and frequency change slowly. This is why amplitude and frequency are considered important factors in the tremor characterization, and thus for its diagnosis. In this paper, a tool for the prediagnosis of the human tremor is presented. This tool uses a low cost device (<$40) and allows to compute the main factors of the human tremor accurately. Real cases have been tested using the algorithms developed in this investigation. The patients suffered from different tremor severities, and the components of amplitude and frequency were computed using a series of tests. These additional measures will help the experts to make better diagnoses allowing them to focus on specific stages of the test or get an overview of these tests. From the experimental, we stated that not all tests are valid for every patient to give a diagnosis. Guided by years of experience, the expert will decide which test or set of tests are the most appropriate for a patient.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

National Highway Traffic Safety Administration, Washington, D.C.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Mode of access: Internet.