997 resultados para Análise da eficácia


Relevância:

20.00% 20.00%

Publicador:

Resumo:

This aim of this work was to carry out an epidemiological study on acetabular fractures in the city of Campinas and surrounds, in view of the few published papers on this subject. Medical files with a diagnosis of acetabular fracture between the years 2004 and 2008 that were made available by the Medical Archiving Service of Hospital das Clínicas, State University of Campinas (UNICAMP) were analyzed by six observers. Data on patients' ages, sex, side affected by the fracture, mechanism of injury, material used for synthesis, complications of the operation, associated fractures, length of hospitalization before and after the surgery, time of total internment and number of physiotherapy sessions before and after the surgery were gathered. It was observed in this population that the left side was more affected; the mechanism of injury that most often caused this type of fracture was automobile accidents; injuries to the sciatic nerve were the commonest surgical complications; and the synthesis material most used was reconstruction plates.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper studies complex sentences with temporal hypotatic clauses and with conditional hypotatic clauses in order to investigate the degree of grammaticalization shown by these two kinds of utterances. Our hypothesis is that the more the hypotatic clause is integrated to the nuclear clause, the greater is the degree of grammaticalization. Such degree of integration was measured according to three groups of factors, and the results show that, regarding two of the variables evaluated, the conditional clauses are the most integrated to their nucleus, but, in another rank of evaluation, the temporal clauses are the most integrated ones. Considering that this study is based on a functionalist view, the results may be interpreted according to the principle that there is a competition of motivations in the use of language, so that each utterance reflects the balance of such forces.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A common breeding strategy is to carry out basic studies to investigate the hypothesis of a single gene controlling the trait (major gene) with or without polygenes of minor effect. In this study we used Bayesian inference to fit genetic additive-dominance models of inheritance to plant breeding experiments with multiple generations. Normal densities with different means, according to the major gene genotype, were considered in a linear model in which the design matrix of the genetic effects had unknown coefficients (which were estimated in individual basis). An actual data set from an inheritance study of partenocarpy in zucchini (Cucurbita pepo L.) was used for illustration. Model fitting included posterior probabilities for all individual genotypes. Analysis agrees with results in the literature but this approach was far more efficient than previous alternatives assuming that design matrix was known for the generations. Partenocarpy in zucchini is controlled by a major gene with important additive effect and partial dominance.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

BACKGROUND: Changes in heart rate during rest-exercise transition can be characterized by the application of mathematical calculations, such as deltas 0-10 and 0-30 seconds to infer on the parasympathetic nervous system and linear regression and delta applied to data range from 60 to 240 seconds to infer on the sympathetic nervous system. The objective of this study was to test the hypothesis that young and middle-aged subjects have different heart rate responses in exercise of moderate and intense intensity, with different mathematical calculations. METHODS: Seven middle-aged men and ten young men apparently healthy were subject to constant load tests (intense and moderate) in cycle ergometer. The heart rate data were submitted to analysis of deltas (0-10, 0-30 and 60-240 seconds) and simple linear regression (60-240 seconds). The parameters obtained from simple linear regression analysis were: intercept and slope angle. We used the Shapiro-Wilk test to check the distribution of data and the t test for unpaired comparisons between groups. The level of statistical significance was 5%. RESULTS: The value of the intercept and delta 0-10 seconds was lower in middle age in two loads tested and the inclination angle was lower in moderate exercise in middle age. CONCLUSION: The young subjects present greater magnitude of vagal withdrawal in the initial stage of the HR response during constant load exercise and higher speed of adjustment of sympathetic response in moderate exercise.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The extract of stevia leaves (Stevia rebaudiana Bertoni) is the only sweetener utilized in sucrose substitution which can be produced totally in Brazil. The objective of this study, was determine the temporal characteristic of sweet and bitter taste of stevia and compare with sucrose at 3 and 10% in the same equi-sweet. The time-intensity curves (T-I) for each substance were collected through the software Sistema de Coleta de Dados Tempo-Intensidade - SCDTI for Windows, where the judges recorded through of mouse the perception of each stimuli inside function of time, for each sample. The parameters of T-I curves collected were: time for intensity maxim (TImax), intensity maxim (Imax), time of decay (Td), time of plato (Platô), area under curve (Area) and total time of stimuli duration (Ttot). The parameters Td, Ttot, Area e Plato of T-I curves, for stimuli sweet in both sweetness level, were significativelly superior for stevia, while Timax e Imax were significativelly inferior (p£0,05), at differences between value for both substances were superior DESS at 10%. Sucrose didn?t present any record for simuli bitter as 3 as 10%, while stevia presented a characteristic T-I curve with intensity and total time of stimuli duration dependent of concentration.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Brazilian regulations prohibit the addition of cocoa butter replacements to chocolate, in total or partial substitution. The objective of the present work was to check the quality standards of four of coating bitter Brasilian chocolate bars and five of coating milk chocolate bars, commercialized in Campinas. In order to check the possible addition of substitutes, the triacylglycerol composition was determined, and the results were analysed by Padley & Timms mathematical method. The triacylglycerol composition of each sample was determined by high temperature gas chromatography (HTGC). The presence of cocoa butter replacements was not detected in the brands of coating chocolate.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Descriptive terminology and sensory profile of three varieties of brazilian varietal white wines (cultivars Riesling, Gewürztraminer and Chardonnay) were developed by a methodology based on the Quantitative Descriptive Analysis (QDA). The sensory panel consensually defined the sensory descriptors, their respective reference materials and the descriptive evaluation ballot. Ten individuals were selected as judges based on their discrimination, reproducibility and individual consensus with the sensory panel. Twelve descriptors were generated showing similarities and differences among the wine samples. Each descriptor was evaluated using a nine-centimeters non-structured scale with the intensity terms anchored at its ends. The collected data were analysed by ANOVA, Tukey test and Principal Component Analysis (PCA). The results showed a great difference within the sensory profile of Riesling and Gewürztraminer wines, whereas Chardonnay wines showed a lesser variation. PCA separated samples into two groups: a first group formed by wines higher in sweetness and fruitty flavor and aroma; and a second group of wines higher in sourness, adstringency, bitterness, alcoholic and fermented flavors.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Purpose: To evaluate the onset time and quality of peribulbar anesthesia with 1% ropivacaine associated or not with hyaluronidase 100 tru/ml for cataract extraction. Methods: Prospective, randomized, double-blind and controlled study including fifty-seven patients, scheduled to undergo peribulbar anesthesia for cataract extraction, allocated to two groups. Group C: 1% ropivacaine with addition of 100 tru/ml hyaluronidase, and Group S 1% ropivacaine, without hyaluronidase. The onset time for globe akinesia was studied at intervals of 2 minutes, using Nicoll's score. We evaluated pain by analogic score during the surgery and the necessity of complementing the anaesthesia. The peribulbar block was considered satisfactory when the Nicoll's score was less than 4. Results: The mean time of onset of block in group C was 4.07 minutes (± 3.24), and in group S 5.03 (± 3.28). There was no statistically significant difference between the groups. Both were similar regarding pain score, no pain was observed in 57.14% of group C, and in 68.97% of group S. The supplementary anesthetic was necessary in 2 cases of group C and in 3 cases of group S. Two cases of bradycardia (heart rate < 50 bpm) were observed during the surgery, and in one case administration of atropine IV was necessary. Conclusion: 1% ropivacaine provided a good quality of anesthesia for cataract extraction, with a faster onset of action in the group with hyaluronidase 100 iu/ml, although without significant difference.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

PURPOSES: 1) To verify the impact of the creation of the Single Technical Record (STR) at the University of Campinas (Unicamp) Hospital das Clínicas, on the preservation period of corneas which were used in elective penetrating keratoplasties, and 2) to compare the primary failure incidence in cornea penetrating keratoplasties regarding the periods before and after the creation of STR. METHODS: A retrospective study was conducted at the Unicamp Hospital, which evaluated 15 consecutive cornea penetrating keratoplasties between January 1st and April 30th, 2000 and 24 consecutive penetrating keratoplasties between May 1st and September 20th of the same year (corneas under the control of the STR), totaling 39 keratoplasties. RESULTS: The mean time between cornea preparation and transplantation was 3.8 days (±1.78) in the period before STR creation, and 6.0 days (±2.97) after STR creation, representing a 36.7% increase in the preservation time. There was a statistically significant difference (p=0.02) between the two groups. No corneal primary failure was observed among the 39 transplanted patients in both groups. CONCLUSION: Based on the results of this study, it can be concluded that this new concept of the State Transplantation System has caused a statistically significant increase in the conservation period of corneas, which may reduce the period of a clear transplant due to an increased loss of endothelial cells, as well as increase the primary failure incidence or result in a high number of corneas that cannot be used due to having exceeded the preservation time recommended by the literature.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física