876 resultados para ANTISENSE OLIGONUCLEOTIDES
Resumo:
The G genotyping of 74 group A rotavirus samples was done by RNA-DNA hybridization (dot-blot) using oligonucleotide probes for the VP7 gene region of the human rotavirus serotypes/genotypes 1, 2, 3 and 4. Thirty-one samples could be genotyped by dot-blot showing the following results: G1 = 16, G4 = 6, G3 = 5, and G2 = 4. The data show circulation of genotypes G1-G4 and the predominance of G1. The knowledge of genotypes provides important information concerning rotavirus circulation in Central Brazil.
Resumo:
In addition to the mutations that underlie most cases of the multiple endocrine neoplasia type 1 (MEN1) syndrome, somatic mutations of the MEN1 gene have also been described in sporadic tumors like gastrinomas, insulinomas and bronchial carcinoid neoplasm. We examined exon 2 of this gene, where most of the mutations have been described, in 148 endocrine and nonendocrine sporadic tumors. DNA was obtained by phenol/chloroform extraction and ethanol precipitation from 92 formalin-fixed, paraffin-embedded samples, and from 40 fresh tumor tissue samples. We used 5 pairs of primers to encompass the complete coding sequence of exon 2 of the MEN1 gene that was screened by the polymerase chain reaction-single-stranded conformation polymorphism (PCR-SSCP) technique in 78 sporadic thyroid cancers: 28 follicular adenomas, 35 papillary carcinomas, 14 follicular carcinomas, and 1 anaplastic thyroid carcinoma. We also examined 46 adrenal lesions (3 hyperplasias, 3 adenomas and 35 adrenocortical carcinomas, 2 pheochromocytomas, 2 ganglioneuroblastomas, and 1 lymphoma) and 24 breast cancers (6 noninvasive, 16 infiltrating ductal, and 2 invasive lobular tumors). The PCR product of 5 tumors suspected to present band shifts by SSCP was cloned. Direct sense and antisense sequencing did not identify mutations. These results suggest that the MEN1 gene is not important in breast, thyroid or adrenal sporadic tumorigenesis. Because the frequency of mutations varies significantly among tumor subgroups and allelic deletions are frequently observed at 11q13 in thyroid and adrenal cancers, another tumor suppressor gene residing in this region is likely to be involved in the tumorigenesis of these neoplasms.
Resumo:
Allergy is characterized by T helper (Th) 2-type immune response after encounter with an allergen leading to subsequent immunoglobulin (Ig) E-mediated hypersensitivity reaction and further allergic inflammation. Allergen-specific immunotherapy (SIT) balances the Th2-biased immunity towards Th1 and T regulatory responses. Adjuvants are used in allergen preparations to intensify and modify SIT. β-(1,2)-oligomannoside constituents present in Candida albicans (C. albicans) cell wall possess Th1-type immunostimulatory properties. The aim of this thesis was to develop a β-(1,2)-linked carbohydrate compound with known structure and anti-allergic properties to be applied as an adjuvant in SIT. First the immunostimulatory properties of various fungal extracts were studied. C. albicans appeared to be the most promising Th1-inducing extract, which led to the synthesis of various mono- or divalent oligomannosides designed on the basis of C. albicans. These carbohydrates did not induce strong cytokine production in human peripheral blood mononuclear cell (PBMC) cultures. In contrast to earlier reports using native oligosaccharides from C. albicans, synthetic -(1,2)-linked mannotetraose did not induce any tumor necrosis factor production in murine macrophages. Next, similarities with synthesized divalent mannosides and the antigenic epitopes of β-(1,2)-linked C. albicans mannan were investigated. Two divalent compounds inhibited specific IgG antibodies binding to below 3 kDa hydrolyzed mannan down to the level of 30–50% showing similar antigenicity to C. albicans. Immunomodulatory properties of synthesized carbohydrate assemblies ranging from mono- to pentavalent were evaluated. A trivalent acetylated dimannose (TADM) induced interleukin-10 (IL-10) and interferon-γ responses. TADM also suppressed birch pollen induced IL-4 and IL-5 responses in allergen (Bet v) stimulated PBMCs of birch pollen allergic subjects. This suppression was stronger with TADM than with other used adjuvants, immunostimulatory oligonucleotides and monophosphoryl lipid A. In a murine model of asthma, the allergen induced inflammatory responses could also be suppressed by TADM on cytokine and antibody levels.
Resumo:
This paper presents the first isolation of bovine respiratory syncytial virus in Brazil and its physicochemical, morphological and molecular characterization. The virus was isolated from 33 samples of nasotracheal secretions, successively inoculated into a Madin-Darby bovine kidney cell culture, which was characterized by physicochemical tests and morphological observation by electron microscopy. The Brazilian sample is an RNA pleomorphic, enveloped, thermolabile and non-hemagglutinating spicular virus. Reverse transcription, followed by nested polymerase chain reaction (nRT-PCR) assay was carried out using oligonucleotides B1, B2A, B3 and B4 for the fusion proteins (F) and B5A, B6A, B7A and B8 for the attachment protein (G). The nRT-PCR-F amplified a fragment of 481 bp corresponding to part of the gene that codes for protein F, whereas nRT-PCR-G amplified a fragment of 371 bp, in agreement with part of the G gene. The virus isolated from Brazilian samples in this study corresponded to the bovine respiratory syncytial virus, and RT-PCR proved to be useful for the diagnosis of bovine clinical samples.
Resumo:
The establishment of dorsal-ventral polarity in Drosophila is a complex process which involves the action of maternal and zygotically expressed genes. Interspecific differences in the expression pattern of some of these genes have been described in other species. Here we present the expression of dorsal-ventral genes during early embryogenesis in the lower dipteran Rhynchosciara americana. The expression of four genes, the ventralizing genes snail (sna) and twist (twi) and the dorsalizing genes decapentaplegic (dpp) and zerknüllt (zen), was investigated by whole-mount in situ hybridization. Sense and antisense mRNA were transcribed in vitro using UTP-digoxigenin and hybridized at 55°C with dechorionated fixed embryos. Staining was obtained with anti-digoxigenin alkaline phosphatase-conjugated antibody revealed with NBT-BCIP solution. The results showed that, in general, the spatial-temporal expression of R. americana dorsal-ventral genes is similar to that observed in Drosophila, where twi and sna are restricted to the ventral region, while dpp and zen are expressed in the dorsal side. The differences encountered were subtle and probably represent a particular aspect of dorsal-ventral axis determination in R. americana. In this lower dipteran sna is expressed slightly later than twi and dpp expression is expanded over the lateral ectoderm during cellular blastoderm stage. These data suggest that the establishment of dorsal-ventral polarity in R. americana embryos follows a program similar to that observed in Drosophila melanogaster.
Resumo:
Nukleotidien ja oligonukleotidien analogeilla on merkittävä rooli virusten aiheuttamien tautien hoidossa. Tämän kaltaiset yhdisteet voivat estää spesifisesti virusten proteiineja tai aktivoida luontaista immuunijärjestelmää, jossa 2-5A:ksi kutsutut lyhyet 2´,5´-sitoutuneet oligomeerit ovat keskeisiä tekijöitä. Nukleotideihin ja oligonukleotideihin pohjautuvien lääkkeiden tehokkuus riippuu pääasiassa aihiolääkestrategiasta, jolla niiden sisäänottoa soluun tehostetaan. Tavanomaisessa aihiolääkestrategiassa negatiivisesti varautuneet fosfaattiryhmät suojataan rasvaliukoisilla biohajoavilla suojaryhmillä, jotta molekyyli läpäisee solukalvon helpommin. Solun sisällä aihiolääke muuttuu aktiiviseksi lääkeaineeksi, kun suojaryhmät irtoavat solun entsyymien, kuten esteraasien vaikutuksesta. Väitöskirjassa arvioitiin esteraasin katalysoiman aihiolääkestrategian soveltuvuutta 2-5A-trimeerille syntetisoimalla kaksi erilaista 2-5A-aihiolääkekandidaattia ja tutkimalla 2-5A:n purkautumista karboksiesteraasi-entsyymin vaikutuksesta. Suojaryhmäsuunnitelma perustui esteraasilabiileihin 2,2-disubstituoituihin asyylioksipropyyliryhmiin ja asyylioksimetyyliryhmiin, joilla suojattiin trimeerien fosfaatti- ja 3´-hydroksyyliryhmät. Tulokset osoittivat, että esteraasilabiilien suojaryhmien irtoaminen 2-5A:sta hidastui merkittävästi, kun yhdisteeseen kertyi negatiivista varausta. Lisäksi suojaryhmien hajotessa muodostui elektrofiilisiä alkyloivia aineita, jotka ovat mahdollisesti toksisia. Näistä syistä johtuen kehitettiin kuusi uudenlaista 2,2,-disubstituoitua 4-asyylitio- 3-oksobutyyliryhmää fosfodiestereiden suojaamiseksi. Suojaryhmät irtoavat sekä esteraasin katalysoimana, että lämpötilan vaikutuksesta. Tämä on hyödyllinen ominaisuus silloin, kun entsyymin affiniteetti negatiivisesti varattuun substraattiin heikkenee. Suojaryhmien hydrolyyttinen ja entsymaattinen stabiilisuus on helposti säädeltävissä, jotta suojauksen purkautumisen nopeus voidaan optimoida. Vapautuneet suojaryhmät eivät ole merkittävästi alkyloivia, sillä niiden ei havaittu alkyloivan glutationia.
Resumo:
TP53, a tumor suppressor gene, has a critical role in cell cycle, apoptosis and cell senescence and participates in many crucial physiological and pathological processes. Identification of TP53 polymorphism in older people and age-related diseases may provide an understanding of its physiology and pathophysiological role as well as risk factors for complex diseases. TP53 codon 72 (TP53:72) polymorphism was investigated in 383 individuals aged 66 to 97 years in a cohort from a Brazilian Elderly Longitudinal Study. We investigated allele frequency, genotype distribution and allele association with morbidities such as cardiovascular disease, type II diabetes, obesity, neoplasia, low cognitive level (dementia), and depression. We also determined the association of this polymorphism with serum lipid fractions and urea, creatinine, albumin, fasting glucose, and glycated hemoglobin levels. DNA was isolated from blood cells, amplified by PCR using sense 5'-TTGCCGTCCCAAGCAATGGATGA-3' and antisense 5'-TCTGGGAAGGGACAGAAGATGAC-3' primers and digested with the BstUI enzyme. This polymorphism is within exon 4 at nucleotide residue 347. Descriptive statistics, logistic regression analysis and Student t-test using the multiple comparison test were used. Allele frequencies, R (Arg) = 0.69 and P (Pro) = 0.31, were similar to other populations. Genotype distributions were within Hardy-Weinberg equilibrium. This polymorphism did not show significant association with any age-related disease or serum variables. However, R allele carriers showed lower HDL levels and a higher frequency of cardiovascular disease than P allele subjects. These findings may help to elucidate the physiopathological role of TP53:72 polymorphism in Brazilian elderly people.
Resumo:
Small cell lung cancer (SCLC) is an aggressive disease, representing 15% of all cases of lung cancer, has high metastatic potential and low prognosis that urgently demands the development of novel therapeutic approaches. One of the proposed approaches has been the down-regulation of BCL2, with poorly clarified and controversial therapeutic value regarding SCLC. The use of anti-BCL2 small interfering RNA (siRNA) in SCLC has never been reported. The aim of the present study was to select and test the in vitro efficacy of anti-BCL2 siRNA sequences against the protein and mRNA levels of SCLC cells, and their effects on cytotoxicity and chemosensitization. Two anti-BCL2 siRNAs and the anti-BCL2 G3139 oligodeoxynucleotide (ODN) were evaluated in SCLC cells by the simultaneous determination of Bcl-2 and viability using a flow cytometry method recently developed by us in addition to Western blot, real-time reverse-transcription PCR, and cell growth after single and combined treatment with cisplatin. In contrast to previous reports about the use of ODN, a heterogeneous and up to 80% sequence-specific Bcl-2 protein knockdown was observed in the SW2, H2171 and H69 SCLC cell lines, although without significant sequence-specific reduction of cell viability, cell growth, or sensitization to cisplatin. Our results question previous data generated with antisense ODN and supporting the present concept of the therapeutic interest in BCL2 silencing per se in SCLC, and support the growing notion of the necessity of a multitargeting molecular approach for the treatment of cancer.
Resumo:
Infection with Bartonella spp may cause cardiac arrhythmias, myocarditis and endocarditis in humans. The aim of the present study was to evaluate a possible association between Bartonella spp bacteremia and endocarditis, arrhythmia and Chagas cardiomyopathy in patients from Brazil and Argentina. We screened for the presence of bacterial 16S rRNA in human blood by PCR using oligonucleotides to amplify a 185-bp bacterial DNA fragment. Blood samples were taken from four groups of subjects in Brazil and Argentina: i) control patients without clinical disease, ii) patients with negative blood-culture endocarditis, iii) patients with arrhythmias, and iv) patients with chronic Chagas cardiomyopathy. PCR products were analyzed on 1.5% agarose gel to visualize the 185-bp fragment and then sequenced to confirm the identity of DNA. Sixty of 148 patients (40.5%) with cardiac disease and 1 of 56 subjects (1.8%) from the control group presented positive PCR amplification for Bartonella spp, suggesting a positive association of the bacteria with these diseases. Separate analysis of the four groups showed that the risk of a Brazilian patient with endocarditis being infected with Bartonella was 22 times higher than in the controls. In arrhythmic patients, the prevalence of infection was 45 times higher when compared to the same controls and 40 times higher for patients with Chagas cardiomyopathy. To the best of our knowledge this is the first report of the association between Bartonella spp bacteremia and Chagas disease. The present data may be useful for epidemiological and prevention studies in Brazil and Argentina.
Resumo:
Antiviral nucleosides are compounds that are used against viruses, such as human immunodeficiency virus (HIV) and hepatitis C virus (HCV). To act as therapeutic agent, the antiviral nucleoside needs to be phosphorylated to nucleotide in the body in three consecutive phosphorylation steps by cellular or viral enzymes. The first phosphorylation to the nucleoside monophosphate is often inefficient and leads to poor antiviral activity. The antiviral efficacy can be improved by applying a prodrug strategy and delivering the antiviral nucleoside directly as its monophosphate. In prodrug strategies of antiviral nucleotides, the negative charges on the phosphate moiety are temporarily masked with protecting groups. Once inside the cell, the protecting groups are removed by enzymatic or chemical processes. Many prodrug strategies apply biodegradable protecting groups, the removal of which is triggered by esterase enzymes. Several studies have, however, demonstrated that the removal rate of the second and subsequent esterase labile protecting groups significantly slows down after the first protecting group is removed due to the negative charge on the phosphodiester intermediate, which disturbs the catalytic site of the enzyme. In this thesis, esterase labile protecting group strategies where the issue of retardation could be avoided were studied. Prodrug candidates of antiviral nucleotides were synthesized and kinetic studies on the chemical and enzymatic stability were carried out. In the synthesized compounds, the second protecting group is cleaved from the monophosphate some other mechanism than esterase triggered activation or the structure of prodrug requires only one protecting group. In addition, esterase labile protecting group which is additionally thermally removable was studied. This protecting group was cleaved from oligomeric phosphodiesters both enzymatically and thermally and seems most attractive of the studied phosphate protecting groups. However, the rate of the thermal removal still is too slow to allow efficient protection of longer oligonucleotides and needs optimization. Key words: antiviral, nucleotide, prodrug, protecting group, biodegradable
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
Metal-ion-mediated base-pairing of nucleic acids has attracted considerable attention during the past decade, since it offers means to expand the genetic code by artificial base-pairs, to create predesigned molecular architecture by metal-ion-mediated inter- or intra-strand cross-links, or to convert double stranded DNA to a nano-scale wire. Such applications largely depend on the presence of a modified nucleobase in both strands engaged in the duplex formation. Hybridization of metal-ion-binding oligonucleotide analogs with natural nucleic acid sequences has received much less attention in spite of obvious applications. While the natural oligonucleotides hybridize with high selectivity, their affinity for complementary sequences is inadequate for a number of applications. In the case of DNA, for example, more than 10 consecutive Watson-Crick base pairs are required for a stable duplex at room temperature, making targeting of sequences shorter than this challenging. For example, many types of cancer exhibit distinctive profiles of oncogenic miRNA, the diagnostics of which is, however, difficult owing to the presence of only short single stranded loop structures. Metallo-oligonucleotides, with their superior affinity towards their natural complements, would offer a way to overcome the low stability of short duplexes. In this study a number of metal-ion-binding surrogate nucleosides were prepared and their interaction with nucleoside 5´-monophosphates (NMPs) has been investigated by 1H NMR spectroscopy. To find metal ion complexes that could discriminate between natural nucleobases upon double helix formation, glycol nucleic acid (GNA) sequences carrying a PdII ion with vacant coordination sites at a predetermined position were synthesized and their affinity to complementary as well as mismatched counterparts quantified by UV-melting measurements.
Resumo:
Gene therapy is predicated upon efficient gene transfer. While viral vectors are the method of choice for transformation efficiency, the immunogenicity and safety concerns remain problematic. Non-viral vectors, on the other hand, have shown high degrees of safety and are mostly non-immunogenic in nature. However, non-viral vectors usually suffer from low levels oftransformation efficiency and transgene expression. Thus, increasing transformation efficiency ofnon-viral vectors, in particular by calcium phosphate co-precipitation technique, is a way of generating a suitable vector for gene therapy and is the aim of this study. It is a long known fact that different cell lines have different transfection efficiencies regardless oftransfection methodology (Lin et a!., 1994). Using commonly available cell lines Madine-Darby Bovine Kidney (MDBK), HeLa and Human Embryonic Kidney (HEK-293), we have shown a decreasing trend ofDNase activity based on a plasmid digestion assay. From densitometry studies, as much as a 40% reduction in DNase activity was observed when comparing HEK-293 (least active) to MDBK (most active). Using various biochemical assays, it was determined that DNase y, in particular, was expressed more highly in MDBK cells than both HeLa and HEK-293. Upon cloning of the bovine DNase y gene, we utilized the sequence information to construct antisense expressing plasmids via both traditional antisense RNA (pASDGneoM) and siRNA (psiRNA-S4, psiRNA-S11 and psiRNA-S16). For the construction ofpASDGneoM, the 3' end of the DNase y was inserted in opposite orientation under a cytomegalovirus (CMV) promoter such that the expression ofRNA complementary to the DNase 2 ymRNA occurred. For siRNA plasmids, the sequence was screened to yield optimal short sequences for siRNA inhibition. The silencing ofbovine DNase y led to an increase in transfection efficiency based on traditional calcium phosphate co-precipitation technique; stable clones of siRNA-producing MDBK cell lines (psiRNA-S4 Bland psiRNA-S4 B4) both demol).strated 4-fold increases in transfection efficiency. Furthermore, serial transfection of antisense DNase y plasmid pASDGneoM and reporter pCMV-~ showed a maximum of 8-fold increase in transfection efficiency when the two separate transfections were carried out 4 hours apart (i.e. transfection ofpASDGneoM, separated by four hours, then transfection ofpCMV-~). Together, these results demonstrate the involvement ofDNase y in reducing transfection efficiency, at least by traditional calcium phosphate technique.
Resumo:
Background: Ang II plays a major role in cardiovascular regulation. Recently, it has become apparent that vascular superoxide anion may play an important role in hypertension development. Treatment with antisense NAD(P)H oxidase or SOD decreased BP in Ang II-infused rats. Wang et al recently reported mice which lack one of the subunits of NAD(P)H oxidase developed hypertension at a much lower extent when compared to the wild type animals infused with Ang II, indicating that superoxide anion contributes to elevation in BP in the Ang II-infused hypertensive model. In the Ang II-infused hypertensive model, altered reactivity of blood vessels is often associated with the elevation of systolic blood pressure. We have observed abnormal tension development and impaired endothelium-dependent relaxation in the isolated aorta of Ang II-infused and DOCA-salt hypertensive rats. Recently, several other cellular signal molecules, including ERK1I2 and PI3K, have been determined to play important roles in the regulation of smooth muscle contraction and relaxation. ERKl/2 and PI3K pathways are also reported to contribute to Ang II induced cell growth, hypertrophy, remodeling and contraction. Moreover, these signaling pathways have shown ROS-sensitive properties. Therefore, the aim of the present study is to investigate the roles of ERKl12 and PI3K in vascular oxidative stress, spontaneous tone and impaired endothelium relaxation in Ang II-infused hypertensive model. Hypothesis: We hypothesize that the activation of ERKl12 and PI3K are elevated in response to an Ang II infusion for 6 days. The elevated activation of phospho-ERKl/2 and PI3K mediated the increased level of vascular superoxide anion, the abnormal vascular contraction and impaired endothelium-dependent vascular relaxation in Ang II-infused hypertensive rats. Methods: Vascular superoxide anion level is measured by lucigenin chemiluminescence. Spontaneous tone and ACh-induced endothelium-dependent relaxation was measured by isometric tension recording in organ chamber. The activity of ERK pathway will be measured by its Western blot of phosphorylation of ERK. PI3K activity was evaluated indirectly by Western blot of the phosphorylation of PDKl, a downstream protein of PI3K signaling pathway. The role of each pathway was also addressed via comparing the responses to the specific inhibitors. Results: Superoxide anion was markedly increased in the isolated thoracic aorta from Ang II-infused rats. There was spontaneous tone developed in rings from Ang II-induced hypertensive but not sham-operated normotensive rats. ACh-induced endothelium-dependent relaxation function is impaired in Ang II-infused hypertensive rats. Superoxide dismutase and NAD(P)H oxidase inhibitor, apocynin, inhibited the abnormal spontaneous tone and ameliorated impaired endothelium-dependent relaxation. The expression of phopho-ERKII2 was enhanced in Ang II-infused rats, indicating the activity of ERK1I2 could be increased. MEK1I2 inhibitors, PD98059 and U126, but not their inactive analogues, SB203580 and U124, significantly reduced the vascular superoxide anion in aortas from Ang II-infused rats. The MEK1I2 inhibitors reduced the spontaneous tone and improved the impaired endothelium-dependent relaxation in aorta of hypertension. These findings supported the role of ERKII2 signaling pathway in vascular oxidative stress, spontaneous tone and impaired endothelium-dependent relaxation in Ang II-infused hypertensive rats. The amount of phospho-PDK, a downstream protein of PI3K was increased in Ang II rats indicating the activity of PI3K activity was elevated. Strikingly, PI3K significantly inhibited the increase of superoxide anion level, abnormal spontaneous tone and restored endothelium-dependent relaxation in Ang II-infused hypertensive rats. These findings indicated the important role of PI3K in Ang II-infused hypertensive rats. Conclusion: ERKII2 and PI3K signaling pathways are sustained activated in Ang II-infused hypertensive rats. The activated ERKII2 and PI3K mediate the increase of vascular superoxide anion level, vascular abnormal spontaneous tone and impaired endothelium-dependent relaxation.
Resumo:
The neuropeptide Th1RFamide with the sequence Phe-Met-Arg-Phe-amide was originally isolated in the clam Macrocallista nimbosa (price and Greenberg, 1977). Since its discovery, a large family ofFl\1RFamide-related peptides termed FaRPs have been found to be present in all major animal phyla with functions ranging from modulation of neuronal activity to alteration of muscular contractions. However, little is known about the genetics encoding these peptides, especially in invertebrates. As FaRP-encoding genes have yet to be investigated in the invertebrate Malacostracean subphylum, the isolation and characterization ofFaRP-encoding DNA and mRNA was pursued in this project. The immediate aims of this thesis were: (1) to amplify mRNA sequences of Procambarus clarkii using a degenerate oligonucleotide primer deduced from the common amino acid sequence ofisolated Procambarus FaRPS, (2) to determine if these amplification products encode FaRP gene sequences, and (3) to create a selective cDNA library of sequences recognized by the degenerate oligonucleotide primer. The polymerase chain reaction - rapid amplification of cDNA ends (PCR-RACE) is a procedure in which a single gene-specific primer is used in conjunction with a generalized 3' or 5' primer to amplify copies ofthe region between a single point in the transcript and the 3' or 5' end of cDNA of interest (Frohman et aI., 1988). PCRRACE reactions were optimized with respect to primers used, buffer composition, cycle number, nature ofgenetic substrate to be amplified, annealing, extension and denaturation temperatures and times, and use of reamplification procedures. Amplification products were cloned into plasmid vectors and recombinant products were isolated, as were the recombinant plaques formed in the selective cDNA library. Labeled amplification products were hybridized to recombinant bacteriophage to determine ligated amplification product presence. When sequenced, the five isolated PCR-RACE amplification products were determined not to possess FaRP-encoding sequences. The 200bp, 450bp, and 1500bp sequences showed homology to the Caenorhabditis elegans cosmid K09A11, which encodes for cytochrome P450; transfer-RNA; transposase; and tRNA-Tyr, while the 500bp and 750bp sequences showed homology with the complete genome of the Vaccinia virus. Under the employed amplification conditions the degenerate oligonucleotide primer was observed to bind to and to amplify sequences with either 9 or 10bp of 17bp identity. The selective cDNA library was obselVed to be of extremely low titre. When library titre was increased, white. plaques were isolated. Amplification analysis of eight isolated Agt11 sequences from these plaques indicated an absence of an insertion sequence. The degenerate 17 base oligonucleotide primer synthesized from the common amino acid sequence ofisolated Procambarus FaRPs was thus determined to be non-specific in its binding under the conditions required for its use, and to be insufficient for the isolation and identification ofFaRP-encoding sequences. A more specific primer oflonger sequence, lower degeneracy, and higher melting temperature (TJ is recommended for further investigation into the FaRP-encoding genes of Procambarlls clarkii.