933 resultados para stressful life events


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Preparation of protective coating possessing antimicrobial properties is present day need as they increase the shelf life of fruits and vegetables. In the present study, preparation of agar-silver nanoparticle film for increasing the shelf life of fruits is reported. Silver nanoparticles (Ag-NPs) biosynthesised using an extract of Ocimum sanctum leaves, were mixed with agar-agar to prepare an agar-silver nanoparticles (A-AgNp) film. This film was surface-coated over the fruits, Citrus aurantifolium (Thornless lime) and Pyrus malus (Apple), and evaluated for the determination of antimicrobial activity of A-AgNp films using disc diffusion method, weight loss and shelf life of fruits. This study demonstrates that these A-AgNp films possess antimicrobial activity and also increase the shelf life of fruits.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Aging is considered one of the main predisposing factors for the development of prostate malignancies. Angiogenesis is fundamental for tumor growth and its inhibition represents a promising therapeutic approach in cancer treatment. Thus, we sought to determine angiogenic responses and the effects of antiangiogenic therapy in the mouse prostate during late life, comparing these findings with the prostatic microenvironment in the Transgenic Adenocarcinoma of Mouse Prostate (TRAMP) model. Male mice (52 week-old FVB) were submitted to treatments with SU5416 (6 mg/kg; i.p.) and/or TNP-470 (15 mg/kg; s.c.). Finasteride was administered (20 mg/kg; s.c.), alone or in association to both inhibitors. The dorsolateral prostate was collected for VEGF, HIF-1α, FGF-2 and endostatin immunohistochemical and Western Blotting analyses and for microvessel density (MVD) count. Senescence led to increased MVD and VEGF, HIF-1α and FGF-2 protein levels in the prostatic microenvironment, similarly to what was observed in TRAMP mice prostate. The angiogenic process was impaired in all the treated groups, demonstrating significantly decreased MVD. Antiangiogenic and/or finasteride treatments resulted in decreased VEGF and HIF-1α levels, especially following TNP-470 administration, either alone or associated to SU5416. The combination of these agents resulted in increased endostatin levels, regardless of the presence of finasteride. Prostatic angiogenesis stimulation during senescence favored the development of neoplastic lesions, considering the pro-angiogenic microenvironment as a common aspect also observed during cancer progression in TRAMP mice. The combined antiangiogenic therapy was more efficient, leading to enhanced imbalance towards angiogenic inhibition in the organ. Finally, finasteride administration might secondarily upregulate the expression of pro-angiogenic factors, pointing to the harmful effects of this therapy. Prostate 75: 484-499, 2015. © 2014 Wiley Periodicals, Inc.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A randomized controlled trial study was performed to evaluate the efficacy of transcutaneous tibial nerve stimulation (TTNS) and sham TTNS, in patients with Parkinson disease (PD) with lower urinary tract symptoms (LUTS). Randomized controlled trial. Thirteen patients with a diagnosis of PD and bothersome LUTS were randomly allocated to one of the following groups: Group I: TTNS group (n = 8) and group II: Sham group (n = 5). Both groups attended twice a week during 5 weeks; each session lasted 30 minutes. Eight patients received TTNS treatment and 5 subjects allocated to group II were managed with sham surface electrodes that delivered no electrical stimulation. Assessments were performed before and after the treatment; they included a 3-day bladder diary, Overactive Bladder Questionnaire (OAB-V8), and the International Consultation on Incontinence Quality of Life Questionnaire Short Form (ICIQ-SF), and urodynamic evaluation. Following 5 weeks of treatment, patients allocated to TTNS demonstrated statistically significant reductions in the number of urgency episodes (P = .004) and reductions in nocturia episodes (P < .01). Participants allocated to active treatment also showed better results after treatment in the OAB-V8 and ICIQ-SF scores (P < .01, respectively). Urodynamic testing revealed that patients in the active treatment group showed improvements in intravesical volume at strong desire to void (P < .05) and volume at urgency (P < .01) when compared to subjects in the sham treatment group. These findings suggest that TTNS is effective in the treatment of LUTS in patients with PD, reducing urgency and nocturia episodes and improving urodynamic parameters as well as symptom scores measured by the OAB-V8 and health-related quality-of-life scores measured by the ICIQ-SF.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

one hundred (n=100) elderly outpatients with diabetic retinopathy taking antihypertensives and/or oral antidiabetics/insulin were interviewed. Adherence was evaluated by the adherence proportion and its association with the care taken in administrating medications and by the Morisky Scale. The National Eye Institute Visual Functioning Questionnaire (NEI VFQ-25) was used to evaluate HRQoL. most (58%) reported the use of 80% or more of the prescribed dose and care in utilizing the medication. The item stopping the drug when experiencing an adverse event, from the Morisky Scale, explained 12.8% and 13.5% of the variability of adherence proportion to antihypertensives and oral antidiabetics/insulin, respectively. there was better HRQoL in the Color Vision, Driving and Social Functioning domains of the NEI VFQ-25. Individuals with lower scores on the NEI VFQ-25 and higher scores on the Morisky Scale presented greater chance to be nonadherent to the pharmacological treatment of diabetes and hypertension.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To assess sexual function (SF) and quality of life (QOL) in women with polycystic ovary syndrome (PCOS). A cross-sectional study was conducted to assess 56 women with PCOS and 102 control women with regular menstrual cycles. To assess SF and QOL in Brazilian women with PCOS with Female Sexual Function Index (FSFI) and the WHOQOL-bref questionnaires. Women with PCOS had a worse evaluation to arousal, lubrication, satisfaction, pain and total FSFI, and there was no difference in sexual desire and orgasm. Besides, they had a worse evaluation concerning health status than controls. The body mass index was inversely correlated to the QOL, especially to the physical, psychological, environment aspects and self-assessment of QOL, but it did not show correlation to the SF. Women with PCOS had a worse sexual function and self-assessment of health condition in comparison to controls. The body weight as isolated symptom was correlated to the worsening in quality of life, but not with the worsening of sexual function.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

to compare the general and specific health-related quality of life (HRQoL) between the Intervention (IG) and Control (CG) groups of coronary artery disease patients after the implementation of Action Planning and Coping Planning strategies for medication adherence and to verify the relationship between adherence and HRQoL. this was a controlled and randomized study. the sample (n=115) was randomized into two groups, IG (n=59) and CG (n=56). Measures of medication adherence and general and specific HRQoL were obtained in the baseline and after two months of monitoring. the findings showed that the combination of intervention strategies - Action Planning and Coping Planning for medication adherence did not affect the HRQoL of coronary artery disease patients in outpatient monitoring.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The chemical industries worldwide are passing through a very particular moment of re-adaptation due to the implementation of an European regulation called, Registration, Evaluation, Authorization and Restriction of Chemicals (REACH). In Brazil, the Brazilian Chemical Industry needs urgently a specific guide of chemical products stability. The main purpose of this work is to present a proposal of a guide of stability for chemical products based on the reference guides of the International Conference on Harmonization (ICH). Thus, this work proposes an innovation in terms of methodology which will be useful for shelf life definition purpose for chemical industry products.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study aimed to check for any significant differences in perceived quality of life, specifically aspects of a physical nature, among volunteers who are more physically active and those less physically active in a university community. The sample consisted of 1,966 volunteers in a university community in Brazil. To assess physical activity levels, volunteers responded to the International Physical Activity Questionnaire (IPAQ), and to analyse the perception of quality of life they responded to WHOQOL-bref, which is classified into three groups according to level of physical activity, taking into account the metabolic equivalent index (MET) over a full week. For comparison, consideration was given to the first and third tertiles, respectively, namely groups of more and less active students. The results indicated that individuals who engaged in more physical activity had a more positive perception of quality of life compared to those who were less active in physical aspects related to the ability to work, energy for day-to-day activities and locomotion.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objectives were to identify factors associated with decreased life satisfaction in community-dwelling elderly and describe such factors according to gender and age bracket. The study interviewed 2,472 elderly individuals 65 years or older without cognitive deficits suggestive of dementia, in probabilistic samples from seven Brazilian cities. All measures were self-reported except for functional performance, indicated by handgrip and gait speed. Women had more chronic diseases, worse functional performance, and greater social involvement when compared to men. The oldest participants showed worse functional performance and less social involvement when compared to the youngest. Low satisfaction was associated with three or more diseases, memory problems, low social involvement, low handgrip strength, and urinary incontinence. The authors conclude that health, functional performance, and social involvement interact with well-being, so interventions targeting these areas can favor quality of life for the elderly.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

INTRODUCTION:proctocolectomy with ileal pouch-anal anastomosis (IPAA) is the standard surgical procedure for the treatment of ulcerative colitis (UC) and is associated with the prospect of cure. Experience gained over the years has demonstrated the occurrence of a high number of complications as well as bowel disorders that can compromise quality of life (QoL).OBJECTIVE:evaluate QoL in patients with IPAA for ulcerative colitis.PATIENTS AND METHODS:the Inflammatory Bowel Disease Questionnaire (IBDQ) was used to assess QoL in patients with IPAA after its validation in Portuguese.RESULTS:thirty-one patients submitted to IPAA by the same group of professionals were evaluated. QoL was classified as regular in all domains evaluated (intestinal and systemic symptoms and emotional and social aspects). There were no differences in relation to gender, type of pouch or postoperative time. However, elderly patients showed a tendency toward lower scores. Having a professional activity was associated with higher scores in systemic symptoms and social aspects (p < 0.05). Patients with ileostomy showed lower values in the domains of systemic symptoms, emotional and social aspects (p <0.05).CONCLUSION:in all domains assessed, patients with IPAA for UC had QoL classified as regular. Ileostomy and lack of professional activity negatively influenced QoL.