990 resultados para Human dermal fibroblasts
Resumo:
We have examined whether the secretion of erythropoietin (Epo) from genetically modified cells could represent an alternative to repeated injections of the recombinant hormone for treating chronic anemias responsive to Epo. Primary mouse skin fibroblasts were transduced with a retroviral vector in which the murine Epo cDNA is expressed under the control of the murine phosphoglycerate kinase promoter. "Neo-organs" containing the genetically modified fibroblasts embedded into collagen lattices were implanted into the peritoneal cavity of mice. Increased hematocrit (> 80%) and elevated serum Epo concentration (ranging from 60 to 408 milliunits/ml) were observed in recipient animals over a 10-month observation period. Hematocrit values measured in recipient mice varied according to the number of implanted Epo-secreting fibroblasts (ranging from 2.5 to 20 x 10(6)). The implantation of neo-organs containing Epo-secreting fibroblasts appeared, therefore, as a convenient method to achieve permanent in vivo delivery of the hormone. We estimated that the biological efficacy of the approach may be relevant for the treatment of human hemoglobinopathies.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
Resumo:
Retinitis pigmentosa (RP) represents a genetically heterogeneous group of retinal dystrophies affecting mainly the rod photoreceptors and in some instances also the retinal pigment epithelium (RPE) cells of the retina. Clinical symptoms and disease progression leading to moderate to severe loss of vision are well established and despite significant progress in the identification of causative genes, the disease pathology remains unclear. Lack of this understanding has so far hindered development of effective therapies. Here we report successful generation of human induced pluripotent stem cells (iPSC) from skin fibroblasts of a patient harboring a novel Ser331Cysfs*5 mutation in the MERTK gene. The patient was diagnosed with an early onset and severe form of autosomal recessive RP (arRP). Upon differentiation of these iPSC towards RPE, patient-specific RPE cells exhibited defective phagocytosis, a characteristic phenotype of MERTK deficiency observed in human patients and animal models. Thus we have created a faithful cellular model of arRP incorporating the human genetic background which will allow us to investigate in detail the disease mechanism, explore screening of a variety of therapeutic compounds/reagents and design either combined cell and gene- based therapies or independent approaches.
Resumo:
Although immune responses leading to rejection of transplantable tumours have been well studied, requirements for epithelial tumour rejection are unclear. Here, we use human growth hormone (hGH) expressed in epithelial cells (skin keratinocytes) as a model neo-self antigen to investigate the consequences of antigen presentation from epithelial cells. Mice transgenic for hGH driven from the keratin 14 promoter express hGH in skin keratinocytes. This hGH-transgenic skin is not rejected by syngeneic non-transgenic recipients, although an antibody response to hGH develops in grafted animals. Systemic immunization of graft recipients with hGH peptides, or local administration of stimulatory anti-CD40 antibody, induces temporary macroscopic graft inflammation, and an obvious dermal infiltrate of inflammatory cells, but not graft rejection. These results suggest that a neo-self antigen expressed in somatic cells in skin can induce an immune response that can be enhanced further by induction of specific immunity systemically or non-specific immunity locally. However, immune responses do not always lead to rejection, despite induction of local inflammatory changes. Therefore, in vitro immune responses and in vivo delayed type hypersensitivity are not surrogate markers for immune responses effective against epithelial cells expressing neoantigens.
Resumo:
Early to mid-term fetuses heal cutaneous incisional wounds without scars; however, fetal response to burn injury has not been ascertained. We present a fetal model of thermal injury and subsequent analysis of fetal and lamb response to burn injury. A reproducible deep dermal burn injury was created in the fetus by application of water at 66 degrees C for 7 seconds, and at 82 degrees C for 10 seconds to the lamb. Macroscopically, the area of fetal scald was undetectable from day 7 post injury, while all lamb scalds were readily identified and eventually healed with scarring. Using a five-point histopathology scoring system for alteration in tissue morphology, differences were detected between control and scalded skin at all stages in lamb postburn, but no difference was detected in the fetal model after day 7. There were also large differences in content of alpha-smooth muscle actin and transforming growth factor-beta 1 between control and scalded lamb and these differences were statistically significant at day 14 (P < 0.01). This novel model of fetal and lamb response to deep dermal injury indicates that the fetus heals a deep burn injury in a scarless fashion. Further elucidation of this specific fetal process of burn injury repair may lead to improved outcome for patients with burn injury.
Resumo:
Given that an important functional attribute of stem cells in vivo is their ability to sustain tissue regeneration, we set out to establish a simple and easy technique to assess this property from candidate populations of human keratinocyte stem cells in an in vivo setting. Keratinocytes were inoculated into devitalized rat tracheas and transplanted subcutaneously into SCID mice, and the epithelial lining regenerated characterized to establish the validity of this heterotypic model. Furthermore, the rate and quality of epidermal tissue reconstitution obtained from freshly isolated unfractionated vs. keratinocyte stem cell-enriched populations was tested as a function of (a) cell numbers inoculated; and (b) the inclusion of irradiated support keratinocytes and dermal cells. Rapid and sustained epidermal tissue regeneration from small numbers of freshly isolated human keratinocyte stem cells validates the utilization of this simple and reliable model system to assay for enrichment of epidermal tissue-reconstituting cells.
Resumo:
Objectives:The aim of this study was to assess the biological rationale for the use of platelet-rich plasma (PRP) by evaluating the effect of different concentrations of PRP on osteoblasts (OB) and fibroblasts (FB) function in vitro. Materials and methods:PRP was obtained from volunteer donors using standard protocols. Primary human cultures of oral FBs and OBs were exposed to both activated and non-activated plasma as well as various concentrations of PRP (2.5 x, 3.5 x and max (4.2-5.5 x)). Cell proliferation was evaluated after 24 and 72 h using an MTT proliferation assay. Production of osteocalcin (OCN), osteoprotegerin (OPG) and transforming growth factor beta 1 (TGF-beta 1) was evaluated in OB after 24 and 72 h. Statistical analysis was performed using one-way ANOVA. Results:PRP-stimulated cell proliferation in both OBs and FBs. The effect of different PRP concentrations on cell proliferation was most notable at 72 h. The maximum effect was achieved with a concentration of 2.5 x, with higher concentrations resulting in a reduction of cell proliferation. Upregulation of OCN levels and downregulation of OPG levels were noted with increasing PRP concentrations at both 24 and 72 h. TGF-beta 1 levels were stimulated by increasing concentrations of PRP, with the increased levels being maintained at 72 h. Conclusions:PRP preparations exert a dose-specific effect on oral FBs and OBs. Optimal results were observed at a platelet concentration of 2.5 x, which was approximately half of the maximal concentrate that could be obtained. Increased concentrations resulted in a reduction in proliferation and a suboptimal effect on OB function. Hence, different PRP concentrations may have an impact on the results that can be obtained in vivo.
Resumo:
The skin localization of steroids following topical application is largely unknown. We determined the distribution of five steroids in human skin using excised epidermal, dermal, and full-thickness membranes in vitro. There was no significant difference in steroid maximum flux through epidermal and full-thickness membranes, other than significantly lower fluxes for the most polar steroid, aldosterone. Hydrocortisone had the highest dermal diffusivity and dermal penetration, and the accumulation of hydrocortisone and corticosterone was higher than that of the other steroids. Slower penetration and higher accumulation in the viable epidermis of progesterone in full-thickness skin were consistent with dermal penetration limitation effects associated with high lipophilicity. Copyright (c) 2006 S. Karger AG, Basel
Resumo:
Tissue engineering of skin based on collagen:PCL biocomposites using a designed co-culture system is reported. The collagen:PCL biocomposites having collagen:PCL (w/w) ratios of 1:4, 1:8, and 1:20 have been proven to be biocompatible materials to support both adult normal human epidermal Keratinocyte (NHEK) and mouse 3T3 fibroblast growth in cell culture, respectively, by Dai, Coombes, et al. in 2004. Films of collagen:PCL biocomposites were prepared using non-crosslinking method by impregnation of lyophilized collagen mats with PCL/dichloromethane solutions followed by solvent evaporation. To mimic the dermal/epidermal structure of skin, the 1:20 collagen:PCL biocomposites were selected for a feasibility study of a designed co-culture technique that would subsequently be used for preparing fibroblast/biocomposite/keratinocyte skin models. A 55.3% increase in cell number was measured in the designed co-culture system when fibroblasts were seeded on both sides of a biocomposite film compared with cell culture on one surface of the biocomposite in the feasibility study. The co-culture of human keratinocytes and 3T3 fibroblasts on each side of the membrane was therefore studied using the same co-culture system by growing keratinocytes on the top surface of membrane for 3 days and 3T3 fibroblasts underneath the membrane for 6 days. Scanning electron microscopy (SEM) and immunohistochemistry assay revealed good cell attachment and proliferation of both human keratinocytes and 3T3 fibroblasts with these two types of cells isolated well on each side of the membrane. Using a modified co-culture technique, a co-cultured skin model presenting a confluent epidermal sheet on one side of the biocomposite film and fibroblasts populated on the other side of the film was developed successfully in co-culture system for 28 days under investigations by SEM and immunohistochemistry assay. Thus, the design of a co-culture system based on 1:20 (w/w) collagen:PCL biocomposite membranes for preparation of a bi-layered skin model with differentiated epidermal sheet was proven in principle. The approach to skin modeling reported here may find application in tissue engineering and screening of new pharmaceuticals. © 2005 Elsevier Inc. All rights reserved.
Resumo:
Characterizing engineered human lung tissue is an important step in developing a functional tissue replacement for lung tissue repair and in vitro analysis. Small tissue constructs were grown by seeding IMR-90 fetal lung fibroblasts and adult microvascular endothelial cells onto a Polyglycolic acid (PGA) polymer template. Introducing the constructs to dynamic culture conditions inside a bioreactor facilitated three-dimensional growth seen in scanning electron microscopy images (SEM). Characterization of the resultant tissue samples was done using SEM imagery, tensile tests, and biochemical assays to quantify extra-cellular matrix (ECM) composition. Tensile tests of the engineered samples indicated an increase in the mechanical properties when compared with blank constructs. Elastin and collagen content was found to average 3.19% and 15.49% respectively in relation to total mass of the tissue samples. The presence of elastin and collagen within the constructs most likely explains the mechanical differences that we noted. These findings suggest that the necessary ECM can be established in engineered tissue constructs and that optimization of this procedure has the capacity to generate the load bearing elements required for construction of a functional lung tissue equivalent.
Resumo:
Currently, there is increasing use of nanomaterials in the food industry thanks to the many advantages offered and make the products that contain them more competitive in the market. Their physicochemical properties often differ from those of bulk materials, which require specialized risk assessment. This should cover the risks to the health of workers and consumers as well as possible environmental risks. The risk assessment methods must go updating due to more widespread use of nanomaterials, especially now that are making their way down to consumer products. Today there is no specific legislation for nanomaterials, but there are several european dispositions and regulations that include them. This review gives an overview of the risk assessment and the existing current legislation regarding the use of nanotechnology in the food industry.
Resumo:
Understanding the impact of extracellular matrix sub-types and mechanical stretch on cardiac fibroblast activity is required to help unravel the pathophysiology of myocardial fibrotic diseases. Therefore, the purpose of this study was to investigate pro-fibrotic responses of primary human cardiac fibroblast cells exposed to different extracellular matrix components, including collagen sub-types I, III, IV, VI and laminin. The impact of mechanical cyclical stretch and treatment with transforming growth factor beta 1 (TGFβ1) on collagen 1, collagen 3 and alpha smooth muscle actin mRNA expression on different matrices was assessed using quantitative real-time PCR. Our results revealed that all of the matrices studied not only affected the expression of pro-fibrotic genes in primary human cardiac fibroblast cells at rest but also affected their response to TGFβ1. In addition, differential cellular responses to mechanical cyclical stretch were observed depending on the type of matrix the cells were adhered to. These findings may give insight into the impact of selective pathological deposition of extracellular matrix proteins within different disease states and how these could impact the fibrotic environment.
Resumo:
Background: Recombinant human endostatin (Endostar) has been widely used to suppress angiogenesis in carcinoma patients. Hypertrophic scar (HS) tissue, much like a carcinoma, is often associated with angiogenesis. However, there have been few studies conducted on the effects of Endostar on HS or its mechanism. Objective: This paper investigated the effects Endostar on the HS of rabbit ears and studied the effects of Endostar on VEGF and TIMP-1 expression. Methods: Sixteen New Zealand white rabbits were used to establish HS models. Then, rabbit ears containing HS were randomly assigned to either the Endostar group or the control group. The changes of appearance and histology were evaluated using the naked eye, hematoxylin eosin staining, and a scar elevation index. The VEGF and TIMP-1 expressions were detected by immunohistochemical staining, RT-PCR, and western blot. Results: The thickness of the connective tissue in the Endostar group were thinner, the numbers of micro vessels and fibroblasts were fewer, and the collagen fibers were smoother. Moreover, the mRNA and protein expressions of VEGF and TIMP-1 in the Endostar group were significantly lower than those in the control group. Conclusion: The results suggested that Endostar reduced the formation of HS by down-regulation of VEGF and TIMP-1 expressions.
Resumo:
This study aimed at evaluating whether human papillomavirus (HPV) groups and E6/E7 mRNA of HPV 16, 18, 31, 33, and 45 are prognostic of cervical intraepithelial neoplasia (CIN) 2 outcome in women with a cervical smear showing a low-grade squamous intraepithelial lesion (LSIL). This cohort study included women with biopsy-confirmed CIN 2 who were followed up for 12 months, with cervical smear and colposcopy performed every three months. Women with a negative or low-risk HPV status showed 100% CIN 2 regression. The CIN 2 regression rates at the 12-month follow-up were 69.4% for women with alpha-9 HPV versus 91.7% for other HPV species or HPV-negative status (P < 0.05). For women with HPV 16, the CIN 2 regression rate at the 12-month follow-up was 61.4% versus 89.5% for other HPV types or HPV-negative status (P < 0.05). The CIN 2 regression rate was 68.3% for women who tested positive for HPV E6/E7 mRNA versus 82.0% for the negative results, but this difference was not statistically significant. The expectant management for women with biopsy-confirmed CIN 2 and previous cytological tests showing LSIL exhibited a very high rate of spontaneous regression. HPV 16 is associated with a higher CIN 2 progression rate than other HPV infections. HPV E6/E7 mRNA is not a prognostic marker of the CIN 2 clinical outcome, although this analysis cannot be considered conclusive. Given the small sample size, this study could be considered a pilot for future larger studies on the role of predictive markers of CIN 2 evolution.
Resumo:
Understanding the molecular mechanisms of oral carcinogenesis will yield important advances in diagnostics, prognostics, effective treatment, and outcome of oral cancer. Hence, in this study we have investigated the proteomic and peptidomic profiles by combining an orthotopic murine model of oral squamous cell carcinoma (OSCC), mass spectrometry-based proteomics and biological network analysis. Our results indicated the up-regulation of proteins involved in actin cytoskeleton organization and cell-cell junction assembly events and their expression was validated in human OSCC tissues. In addition, the functional relevance of talin-1 in OSCC adhesion, migration and invasion was demonstrated. Taken together, this study identified specific processes deregulated in oral cancer and provided novel refined OSCC-targeting molecules.