Avaliação in vitro do aparelho DIAGNOdent para diagnóstico oclusal

The aim of this study was to determine the effectiveness and reliability of laser fluorescence measurements in relation to occlusal caries diagnosis. DIAGNOdent 2095 (Kavo, Biberach, Germany), which has been developed especially for caries diagnosis, was utilized. Five (5) teeth were examined in the pilot test; after that, ten (10) teeth were examined in order to calibrate both examiners. Data were obtained from 66 teeth (36 molars and 30 premolars), totalizing 144 sites identified through photographs of the occlusal surfaces. Reproducibility was evaluated in 10 teeth. The interexaminer Spearman correlation (r) was 0.89 and the intra-examiner, 0.93 and 0.97 (examiner A and B, respectively). Validation was carried out by histological examination (stereomicroscope). For the two examiners the sensitivity of the device was relatively high, varying from 0.81 to 1.00, while specificity varied according to which validation criterion was used (0.77 - 0.86: enamel lesion / 0.52 - 0.59: dentin lesion). It was concluded that DIAGNodent presented good capacity of identifying any alteration of the dental surface, nevertheless it presents the disadvantage of accomplishing many false-positive diagnosis when the validation criterion is dentin lesion.

Correlação radiológica e histológica de lesões mamárias não-palpáveis em pacientes submetidas a marcação pré-cirúrgica, utilizando-se o sistema BI-RADS

OBJECTIVE: To evaluate the positive predictive value for BI-RADS (Breast Imaging Reporting and Data System) categories 3, 4 and 5, correlating mammographic and histological diagnosis in non-palpable breast lesions. MATERIALS AND METHODS: Analytical-descriptive study of 169 women submitted to stereotactic localization for surgical biopsy of non-palpable breast lesions. Mammographic and histological findings were correlated, analyzing the predictive positive value for each category. RESULTS: Forty-two (24.8%) cases were diagnosed with breast cancer - only one in category 3, 19 in category 4, and 22 in category 5. The positive predictive value for categories 3, 4A, 4B, 4C and 5 were, respectively, 3.4%, 10.3%, 11.3%, 36% and 91.7%. Microcalcifications were the most frequent finding related to malignancy, present in 61.5% of these cases. CONCLUSION: The present study has demonstrated that BI-RADS allows a safe prediction of high suspicion of malignancy in lesions category 5 and low suspicion for category 3. As regards the category 4, the positive predictive value has shown a progressive increase in subcategories A, B and C, demonstrating that this subclassification represents an invaluable contribution for a more detailed and accurate assessment of lesions suspicious for malignancy.

Behaviour of albino and melanic variants of Biomphalaria glabrata Say, 1818 (Mollusca: Planorbidae) following infection by Schistosoma mansoni Sambon, 1907

The behaviour of the albino and melanic variants of Biomphalaria glabrata of Belo Horizonte (MG. Brazil) was studied comparatively, in terms of their respective susceptibilities to infection by Schistosoma mansoni of the same origin, through observation of the elimination of cercariae for a three-month period and the calculation of mortality and infection rates, in control and in infected snails. The number of amoebocytes, granulocytes and hyalinocytes in the circulating hemolymph during different periods of infection was analyzed. The evolution of the infection in the tissues was observed by means of histological cross-sections. The melanic variant showed greater susceptibility to infection and a higher mortality rate. The albino variant showed a higher number of circulating amoebocytes, both granulocytes and hyalinocytes. A higher number of degenerated sporocysts were seen in the histological cross-sections of the albino variant. The results suggest that the melanic variant of B. glabrata was more susceptible to infection by S. mansoni than was the albino variant.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Cumulative doses of radioiodine in the treatment of differentiated thyroid carcinoma: knowing when to stop

OBJECTIVE: Evaluate the efficacy of cumulative doses (CDs) of 131I-iodide therapy (RIT) in differentiated thyroid cancer (DTC). SUBJECTS AND METHODS: The probability of progressive disease according to CDs was evaluated in patients < 45 years old and > 45 years old and correlated to tumor-node-metastasis (TNM), thyroglobulin values, histological types and variants, age, and zduration of the disease. RESULTS: At the end of a follow-up period of 69 ± 56 months, 85 out of 150 DTC patients submitted to fixed doses RIT had no evidence of disease, 47 had stable disease and 18 had progressive disease. Higher CDs were used in the more aggressive variants (p < 0.0001), higher TNM stages (p < 0.0001), and follicular carcinomas (p = 0.0034). Probability of disease progression was higher with CDs > 600 mCi in patients > 45 years old and with CDs > 800 mCi in patients < 45 years. CONCLUSION: Although some patients may still respond to high CDs, the impact of further RIT should be carefully evaluated and other treatment strategies may be warranted.

Politetrafluoroetileno e esclera humana no tratamento cirúrgico de perfuração escleral em coelhos

Purpose: An experimental study to evaluate the behavior of polytetrafluoroethylene (Gore-Tex®) compared with human sclera, in scleral perforations induced in rabbits eyes was performed. Methods: Twenty-two eyes of rabbits were submitted to scleral perforation followed by Gore-Tex® graft in the left eye and human sclera graft in the right eye respectively. During one month the postoperative evolution was analyzed every day: intensity of hyperemia, presence of infection, secretion, rejection and tonicity of the eyes. Results: No cases of secretion, infection or rejection were observed. The histological sections showed fibrosis in the eyes with Gore-Tex®, good adhesion and epithelization. Conclusion: The Gore-Tex® showed to be a plausible material to be used as graft in scleral defects with some advantages such as easy obtention, good handling and durability.

Assessment of ocular surface toxicity after topical instillation of nitric oxide donors

PURPOSE: To evaluate the ocular surface toxicity of two nitric oxide donors in ex vivo and in vivo animal models: S-nitrosoglutathione (GSNO) and S-nitroso-N-acetylcysteine (SNAC) in a hydroxypropyl methylcellulose (HPMC) matrix at final concentrations 1.0 and 10.0 mM. METHODS: Ex vivo GSNO and SNAC toxicities were clinically and histologically analyzed using freshly excised pig eyeballs. In vivo experiments were performed with 20 albino rabbits which were randomized into 4 groups (5 animals each): Groups 1 and 2 received instillations of 150 µL of aqueous HPMC solution containing GSNO 1.0 and 10.0 mM, respectively, in one of the eyes; Groups 3 and 4 received instillations of 150 µL of aqueous HPMC solution-containing SNAC 1.0 and 10.0 mM, respectively, in one of the eyes. The contralateral eyes in each group received aqueous HPMC as a control. All animals underwent clinical evaluation on a slit lamp and the eyes were scored according to a modified Draize eye test and were histologically analyzed. RESULTS: Pig eyeballs showed no signs of perforation, erosion, corneal opacity or other gross damage. These findings were confirmed by histological analysis. There was no difference between control and treated rabbit eyes according to the Draize eye test score in all groups (p>0.05). All formulations showed a mean score under 1 and were classified as non-irritating. There was no evidence of tissue toxicity in the histological analysis in all animals. CONCLUSION: Aqueous HPMC solutions containing GSNO and SNAC at concentrations up to 10.0 mM do not induce ocular irritation.

Lipoidoproteinose

OBJETIVO: Apresentar as características clínicas, tratamento cirúrgico e achado histológico de um caso de lipoidoproteinose. DESCRIÇÃO DO CASO: Criança do sexo masculino, cinco anos de idade, branco, que procurou atendimento odontológico na Universidade. A mãe da criança relatou presença de intensa halitose e dificuldade na alimentação e higienização bucal, decorrentes de crescimento gengival generalizado nos arcos dentários superior e inferior. No exame clínico, verificaram-se comprometimento funcional e estético generalizado (rouquidão, artralgia bilateral no joelho e tornozelo, lesões tumorais nas orelhas, entre outros), além de extensa hiperplasia gengival em ambos os arcos dentários. Optou-se pelo tratamento cirúrgico, com remoção do tecido hiperplásico e exodontia de todos os dentes decíduos e de dois permanentes. O exame histopatológico da peça cirúrgica confirmou o diagnóstico de lipoidoproteinose. COMENTÁRIOS: A lipoidoproteinose é uma doença rara caracterizada pela deposição da substância hialina na pele, membranas mucosas e nos órgãos internos. Os sinais que podem surgir após o nascimento, são: rouquidão; lesões pápulo-nodulares na cabeça, pescoço e membros; lesões papulares amareladas nas margens das pálpebras. O curso desta doença é benigno e crônico.

Bone response to biosilicates® with different crystal phases

The aim of this study was to investigate the histological and histomorphometrical bone response to three Biosilicates with different crystal phases comparing them to Bioglass®45S5 implants used as control. Ceramic glass Biosilicate and Bioglass®45S5 implants were bilaterally inserted in rabbit femurs and harvested after 8 and 12 weeks. Histological examination did not revealed persistent inflammation or foreign body reaction at implantation sites. Bone and a layer of soft tissue were observed in close contact with the implant surfaces in the medullary canal. The connective tissue presented few elongated cells and collagen fibers located parallel to implant surface. Cortical portion after 8 weeks was the only area that demonstrated significant difference between all tested materials, with Biosilicate 1F and Biosilicate 2F presenting higher bone formation than Bioglass®45S5 and Biosilicate® vitreo (p=0.02). All other areas and periods were statistically non-significant (p>0.05). In conclusion, all tested materials were considered biocompatible, demonstrating surface bone formation and a satisfactory behavior at biological environment.

Subcutaneous connective tissue response to primary root canal filling materials

This study evaluated the response of the subcutaneous connective tissue of BALB/c mice to root filling materials indicated for primary teeth: zinc oxide/eugenol cement (ZOE), Calen paste thickened with zinc oxide (Calen/ZO) and Sealapex sealer. The mice (n=102) received polyethylene tube implants with the materials, thereby forming 11 groups, as follows: I, II, III: Calen/ZO for 7, 21 and 63 days, respectively; IV, V, VI: Sealapex for 7, 21 and 63 days, respectively; VII, VIII, IX: ZOE for 7, 21 and 63 days, respectively; X and XI: empty tube for 7 and 21 days, respectively. The biopsied tissues were submitted to histological analysis (descriptive analysis and semi-quantitative analysis using a scoring system for collagen fiber formation, tissue thickness and inflammatory infiltrate). A quantitative analysis was performed by measuring the area and thickness of the granulomatous reactionary tissue (GRT). Data were analyzed by Kruskal-Wallis, ANOVA and Tukey's post-hoc tests (?=0.05). There was no significant difference (p>0.05) among the materials with respect to collagen fiber formation or GRT thickness. However, Calen/ZO produced the least severe inflammatory infiltrate (p<0.05). The area of the GRT was significantly smaller (p<0.05) for Calen/ZO and Sealapex. In conclusion, Calen/ZO presented the best tissue reaction, followed by Sealapex and ZOE.

Histopathological evaluation of root canal filling materials for primary teeth

This study aimed to assess the response of apical and periapical tissues of dogs' teeth after root canal filling with different materials. Forty roots from dogs' premolars were prepared biomechanically and assigned to 4 groups filled with: Group I: commercial calcium hydroxide and polyethylene glycol-based paste (Calen®) thickened with zinc oxide; Group II: paste composed of iodoform, Rifocort® and camphorated paramonochlorophenol; Group III: zinc oxide-eugenol cement; Group IV: sterile saline. After 30 days, the samples were subjected to histological processing. The histopathological findings revealed that in Groups I and IV the apical and periapical regions exhibited normal appearance, with large number of fibers and cells and no resorption of mineralized tissues. In Group II, mild inflammatory infiltrate and mild edema were observed, with discrete fibrogenesis and bone resorption. Group III showed altered periapical region and thickened periodontal ligament with presence of inflammatory cells and edema. It may be concluded that the Calen paste thickened with zinc oxide yielded the best tissue response, being the most indicated material for root canal filling of primary teeth with pulp vitality.

Subcutaneous tissue response of isogenic mice to calcium hydroxide-based pastes with chlorhexidine

This study was evaluated the response of subcutaneous connective tissue of isogenic mice to calcium hydroxide-based pastes with chlorhexidine digluconate (CHX). Seventy isogenic male BALB/c mice aged 6-8 weeks and weighing 15-20 g were randomly assigned to 8 groups. The animals received polyethylene tube implants as follows: Groups I, II, and III (n=10) - Calen® paste mixed with 0.4% CHX (experimental paste; Calen/CHX) for 7, 21, and 63 days, respectively; Groups IV, V, and VI (n=10) - UltraCal™ paste mixed with 2% CHX (experimental paste supplied by Ultradent Products Inc.; Ultracal/CHX) for 7, 21, and 63 days, respectively; and Groups VII and VIII (n=5): empty tube for 7 and 21 days, respectively. At the end of the experimental periods, the implants were removed together with the surrounding tissues (skin and subcutaneous connective tissue). The biopsied tissues were subjected to routine processing for histological analysis. Using a descriptive analysis and a four-point (0-3) scoring system, the following criteria were considered for qualitative and quantitative analysis of the tissue around the implanted materials: collagen fiber formation, tissue thickness and inflammatory infiltrate. A quantitative analysis was performed by measuring the thickness (µm), area (µm²) and perimeter (µm) of the reactionary granulomatous tissue formed at the tube ends. Data were analyzed statistically by the Kruskal-Wallis test and Dunn's post-test (α=0.05). Calen/CHX showed biocompatibility with the subcutaneous and reactionary tissues, with areas of discrete fibrosis and normal conjunctive fibrous tissue, though without statistically significant difference (p>0.05) from the control groups. In Groups I to III, there was a predominance of score 1, while in Groups IV to VI scores 2 and 3 predominated for all analyzed parameters. UltraCal/CHX, on the other hand, induced the formation of an inflammatory infiltrate and abundant exudate, suggesting a persistent residual aggression from the material, even 63 days after implant placement. In conclusion, the Calen paste mixed with 0.4% CHX allowed an adequate tissue response, whereas the UltraCal paste mixed with 2% CHX showed unsatisfactory results.

Cola beverage consumption delays alveolar bone healing: a histometric study in rats

Epidemiological studies have suggested that cola beverage consumption may affect bone metabolism and increase bone fracture risk. Experimental evidence linking cola beverage consumption to deleterious effects on bone is lacking. Herein, we investigated whether cola beverage consumption from weaning to early puberty delays the rate of reparative bone formation inside the socket of an extracted tooth in rats. Twenty male Wistar rats received cola beverage (cola group) or tap water (control group) ad libitum from the age of 23 days until tooth extraction at 42 days and euthanasia 2 and 3 weeks later. The neoformed bone volume inside the alveolar socket was estimated in semi-serial longitudinal sections using a quantitative differential point-counting method. Histological examination suggested a decrease in the osteogenic process within the tooth sockets of rats from both cola groups, which had thinner and sparser new bone trabeculae. Histometric data confirmed that alveolar bone healing was significantly delayed in cola-fed rats at three weeks after tooth extraction (ANOVA, p = 0.0006, followed by Tukey's test, p < 0.01). Although the results of studies in rats cannot be extrapolated directly to human clinical dentistry, the present study provides evidence that cola beverage consumption negatively affect maxillary bone formation.

Influence of Hero Apical instruments on cleaning ovoid-shaped root canals

The cleaning capacity of Hero 642 nickel-titanium files, complemented by the Hero Apical instruments in flattened roots, was determined by histological analysis, considering the area of action of the instruments on the coronal walls and the presence of remaining debris. Twenty-four single-canal, human mandibular incisors were divided into three groups and prepared as follows: GI, instrumented with Hero 642 NiTi files 30/.06, 25/.06, 20/.06, 25/.06, and 30/.06; GII, instrumented as GI followed by Hero Apical size 30/.06; GIII, instrumented as GI followed by Hero Apical sizes 30/.06 and 30/.08, then returning to 30/.06 with pendulum movements. The apical thirds were prepared for histological processing, analyzed at 40× magnification and the images were examined morphometrically. Statistical analysis showed that GIII presented the best results for removing debris (5.22% ± 4.13), with more contact between the instruments and the root canal walls (19.31% ± 0.15). This differed statistically from GI (14.04% ± 4.96 debris removal, with 42.96% ± 7.11 instrument contact) and GII (12.62% ± 5.76 debris removal, with 35.01% ± 0.15 instrument contact). Root canal preparation with Hero 642, complemented by Hero Apical instruments (30/.06 and 30/.08, then re-instrumented with Hero Apical 30/.06 using pendulum movements), was more efficient for debris removal and allowed more contact of the instruments with the root canal walls. GII presented the worst results.

Effectiveness of different final irrigation protocols in removing debris in flattened root canals

This study evaluated in vitro the capacity of debris removal from the apical third of flattened root canals, using different final irrigation protocols. Thirty human mandibular central incisors with a mesiodistal flattened root were prepared using rotary instrumentation by Endo-Flare 25.12 and Hero 642 30.06, 35.02, 40.02 files, irrigated with 2 mL of 1% NaOCl after each file. The specimens were randomly distributed into 5 groups according to the final irrigation of root canals: Group I: 10 mL of distilled water (control), Group II: 10 mL of 1% NaOCl for 8 min, Group III: 2 mL of 1% NaOCl for 2 min (repeated 4 times), Group IV: 10 mL of 2.5% NaOCl for 8 min, and Group V: 10 mL of 2.5% NaOCl for 2 min (repeated 4 times). The apical thirds of the specimens were subjected to histological processing and 6-μm cross-sections were obtained and stained with hematoxylin-eosin. The specimens were examined under optical microscopy at ×40 magnification and the images were subjected to morphometric analysis using the Scion image-analysis software. The total area of root canal and the area with debris were measured in square millimeters. Analysis of variance showed no statistically significant difference (p>0.05) among the groups GI (2.39 ± 3.59), GII (2.91 ± 2.21), GIII (0.73 ± 1.36), GIV (0.95 ± 0.84) and GV (0.51 ± 0.22). In conclusion, the final irrigation protocols evaluated in this study using the Luer syringe presented similar performance in the removal of debris from the apical third of flattened root canals.