The attribution of motives to organizational citizenship behaviors : the influence of personality, gender and ethnicity

A major area of research in the realm of Industrial/Organizational Psychology is the exploration of specific job performance behaviors such as organizational citizenship behaviors (OCBs). However, there is a dearth of research examining how peers react to OCBs and the performers of such behaviors. Bolino noted that determining how people attribute motives to these OCBs is an important yet unanswered question in industrial/organizational psychology. The present study attempted to provide insight on what observer (or rater) traits affect the motives attributed to organizational citizenship behaviors. In particular, the effects of personality traits such as the Big Five personality factors, self-monitoring, individualism-collectivism, negative affectivity and identity factors such as cultural mistrust, ethnic orientation, and perceived similarity were examined. A within-subjects survey design was used to collect data on six hypothetical organizational citizenship behaviors from a sample of 369 participants. The gender and ethnicity of the individuals performing the hypothetical organizational citizenship behaviors were manipulated (i.e., male or female; African-American, Hispanic, or White). Results indicated that both similarity (t(368)=5.13; p .01) and personality factors (R2 =.06 for genuine motives and R2 = .05 for self-serving motives) had an effect on which motive (genuine or self-serving) was attributed to organizational citizenship behaviors. Support was found for an interaction between similarity and the observer's personality trait of conscientiousness when attributing genuine motives to organizational citizenship behaviors. Finally, specific organizational citizenship behaviors such as altruism were linked to genuine motives while OCBs like conscientiousness, sportsmanship, and civic virtue were associated with self-serving motives.

Straight but not Narrow; Within-Gender Variation in the Gender-Specificity of Women's Sexual Response

Gender differences in the specificity of sexual response have been a primary focus in sexual psychophysiology research, however, within-gender variability suggests sexual orientation moderates category-specific responding among women; only heterosexual women show gender-nonspecific genital responses to sexual stimuli depicting men and women. But heterosexually-identified or “straight” women are heterogeneous in their sexual attractions and include women who are exclusively androphilic (sexually attracted to men) and women who are predominantly androphilic with concurrent gynephilia (sexually attracted to women). It is therefore unclear if gender-nonspecific responding is found in both exclusively and predominantly androphilic women. The current studies investigated within-gender variability in the gender-specificity of women’s sexual response. Two samples of women reporting concurrent andro/gynephilia viewed (Study 1, n = 29) or listened (Study 2, n = 30) to erotic stimuli varying by gender of sexual partner depicted while their genital and subjective sexual responses were assessed. Data were combined with larger datasets of predominantly gyne- and androphilic women (total N = 78 for both studies). In both studies, women reporting any degree of gynephilia, including those who self-identified as heterosexual, showed significantly greater genital response to female stimuli, similar to predominantly gynephilic women; gender-nonspecific genital response was observed for exclusively androphilic women only. Subjective sexual arousal patterns were more variable with respect to sexual attractions, likely reflecting stimulus intensity effects. Heterosexually-identified women are therefore not a homogenous group with respect to sexual responses to gender cues. Implications for within-gender variation in women’s sexual orientation and sexual responses are discussed.

Effects of retirement on cognitive function: A gender and international perspecive

Background: As the global population is ageing, studying cognitive impairments including dementia, one of the leading causes of disability in old age worldwide, is of fundamental importance to public health. As a major transition in older age, a focus on the complex impacts of the duration, timing, and voluntariness of retirement on health is important for policy changes in the future. Longer retirement periods, as well as leaving the workforce early, have been associated with poorer health, including reduced cognitive functioning. These associations are hypothesized to differ based on gender, as well as on pre-retirement educational and occupational experiences, and on post-retirement social factors and health conditions. Methods: A cross-sectional study is conducted to determine the relationship between duration and timing of retirement and cognitive function, using data from the five sites of International Mobility in Aging Study (IMIAS). Cognitive function is assessed using the Leganes Cognitive Test (LCT) scores in 2012. Data are analyzed using multiple linear regressions. Analyses are also done by site/region separately (Canada, Latin America, and Albania). Robustness checks are done with an analysis of cognitive change from 2012 to 2014, the effect of voluntariness of retirement on cognitive function. An instrumental variable (IV) approach is also applied to the cross-sectional and longitudinal analyses as a robustness check to address the potential endogeneity of the retirement variable. Results: Descriptive statistics highlight differences between men and women, as well as between sites. In linear regression analysis, there was no relationship between timing or duration of retirement and cognitive function in 2012, when adjusting for site/region. There was no association between retirement characteristics and cognitive function in site/region/stratified analyses. In IV analysis, longer retirement and on time or late retirement was associated with lower cognitive function among men. In IV analysis, there is no relationship between retirement characteristics and cognitive function among women. Conclusions: While results of the thesis suggest a negative effect of retirement on cognitive function, especially among men, the relationship remains uncertain. A lack of power results in the inability to draw conclusions for site/region-specific analysis and site-adjusted analysis in both linear and IV regressions.

Qualitative Comparative Analysis as a Tool for Concept Clarification, Typology Building, and Contextualized Comparisons in Gender and Feminist Research

Qualitative Comparative Analysis (QCA) is a method for the systematic analysis of cases. A holistic view of cases and an approach to causality emphasizing complexity are some of its core features. Over the last decades, QCA has found application in many fields of the social sciences. In spite of this, its use in feminist research has been slower, and only recently QCA has been applied to topics related to social care, the political representation of women, and reproductive politics. In spite of the comparative turn in feminist studies, researchers still privilege qualitative methods, in particular case studies, and are often skeptical of quantitative techniques (Spierings 2012). These studies show that the meaning and measurement of many gender concepts differ across countries and that the factors leading to feminist success and failure are context specific. However, case study analyses struggle to systematically account for the ways in which these forces operate in different locations.

How to achieve gender diversity in top management : A qualitative study of gender equal companies listed on the Swedish stock exchange

Alarming statistics provides that only 10,2 percentage of companies listed on the Swedish stock exchange has achieved gender equality in their top management. The fact is that women being discriminated, since men dominates these positions of power. The study is of a qualitative nature and aims to achieve a deeper understanding and knowledge contribution of how gender equal companies´ has achieved this gender diversity in their top management. Sweden's highest ranking business leaders has been interviewed in order to obtain their view, and the companies they represent, in order to get an answer to what the most important requirements has been in the achievement. The study's main result has shown that strong core values and corporate culture are basic and required condition for a successful gender equality strategy. A deliberate or emergent strategy can then be successfully implemented, and it is mainly the impact of structural barriers that determine which strategy a company uses. At a deliberate strategy, following measures are in additional to core values and corporate cultural crucial; commitment towards gender equality, a specific plan with clear objectives, and a conscious objective recruitment process. The result found aboute these two factors and three measures also identified a required specific order to follow in order to achieve gender diversity in top management. These findings, which in a near future, aims to contribute to a more gender equal Sweden.

«We need more women in managerial jobs» – Gender equality and management in the Nordic context : Deconstruction and critical perspectives

Focusing on the Nordic context, this article highlights complexities between gender equality discourse established at the societal level and discursive practice in organizations, particularly in relation to management, managing and managers. This research task is carried out by deconstructing a management text, and grounding the deconstruction in critical feminist literature. This analysis illustrates how managerial discourse is challenged and questioned by pro-egaliterian arguments in the Nordic context. However, it also demonstrates the pervasiveness of the gendered elements in managerial discourse, which relies on specific conceptions of parenthood where motherhood is constructed as problematic whereas fatherhood remains absent – and thus unproblematic. It is suggested that the ‘Nordic case’ provides a fruitful basis for similar studies in other societal contexts in Europe.

Injustice Everywhere: Hemingway's Struggle with Race, Gender, and Aesthetics

The purpose of this study was to critically evaluate the aesthetic decisions and theoretical complexity of three of Ernest Hemingway’s most experimental texts: IN OUR TIME, TO HAVE AND HAVE NOT, and THE GARDEN OF EDEN, and to show that the usually maligned Hemingway was an author invested in the avant-garde and in analyzing and dissecting rigid societal rules, not championing them. Through critical analysis this study examined how Hemingway makes specific aesthetic decisions in order to more clearly examine the disparity between whites and both women and racial minorities in America. The problems that Hemingway makes clear through his art are meant to have a profound effect upon the reader and encourage re-evaluation of societal rules, their purpose, and their fairness to those who are not white, male, and typically in a position of power. The findings demonstrate that Hemingway’s entire oeuvre is open to re-interpretation on the basis of a progressive view of the author.

Role of gender in transthyretin-related amyloidosis: an international perspective based on the Transthyretin Amyloid Outcomes Survey (THAOS)

Background. Transthyretin amyloidosis (ATTR) is an underdiagnosed disease caused by destabilization of transthyretin (TTR) due to pathogenic mutations (ATTRm) or aging (ATTRwt). We explored the role of gender in determining clinical picture using the largest available database on ATTR, the ongoing Transthyretin Amyloid Outcomes Survey (THAOS) international registry. Methods. Data through 1st April 2019 were explored. Symptomatic ATTRm (n=3737), asymptomatic ATTRm (n=644) and ATTRwt (n=874) patients were studied. Results. Male prevalence was 61% in the entire registry, 53% in ATTRm and 95% in ATTRwt. In the overall cohort, cardiac phenotype was more frequent in males (30.7% vs 10.5%, p<0.001). Among ATTRm, 72.3% of patients with amyloidotic cardiomyopathy (ATTR-CM) were males (p<0.001) but echocardiographic features showed no substantial gender differences. Sensory abnormalities (70.1% vs 64.1%, p<0.001), autonomic abnormalities (60% vs 48.5%, p<0.001) and walking disabilities were more frequent among ATTRm males. Carpal tunnel syndrome was more frequent in ATTRm males (18.6% vs 15.5%, p=0.014). In ATTRwt cohort, females had a more pronounced (but anyhow mild) walking disability. Male-to-female ratio varied within genotype, from 0.61 in Val30Met to 11.11 in ATTRwt; furthermore, males’ imbalance was more evident among symptomatic patients rather than in asymptomatic ones. Male gender, age at presentation and specific genotype were independently associated with the presence of ATTR-CM. Conclusions. In ATTR, cardiac involvement is more frequent in men, supporting the hypothesis that some biologic characteristics may “protect” from myocardial amyloid infiltration in women. Further investigations are needed to identify possible underlying protective mechanism and orient the research for innovative, gender-tailored therapeutic approaches.

Laparoscopic Antireflux Surgery In Patients With Extra Esophageal Symptoms Related To Asthma.

Asthma, laryngitis and chronic cough are atypical symptoms of the gastroesophageal reflux disease. To analyze the efficacy of laparoscopic surgery in the remission of extra-esophageal symptoms in patients with gastroesophageal reflux, related to asthma. Were reviewed the medical records of 400 patients with gastroesophageal reflux disease submitted to laparoscopic Nissen fundoplication from 1994 to 2006, and identified 30 patients with extra-esophageal symptoms related to asthma. The variables considered were: gender, age, gastroesophageal symptoms (heartburn, acid reflux and dysphagia), time of reflux disease, treatment with proton pump inhibitor, use of specific medications, treatment and evolution, number of attacks and degree of esophagitis. Data were subjected to statistical analysis, comparing the pre- and post-surgical findings. The comparative analysis before surgery (T1) and six months after surgery (T2) showed a significant reduction on heartburn and reflux symptoms. Apart from that, there was a significant difference between the patients with daily crises of asthma (T1 versus T2, 45.83% to 16.67%, p=0.0002) and continuous crises (T1, 41.67% versus T2, 8.33%, p=0.0002). Laparoscopic Nissen fundoplication was effective in improving symptoms that are typical of reflux disease and clinical manifestations of asthma.

Site Specific Spin Dynamics In Bafe2as2: Tuning The Ground State By Orbital Differentiation.

The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.

Survival Extrapolation In The Presence Of Cause Specific Hazards.

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Post Hoc Analysis Of The Patricia Randomized Trial Of The Efficacy Of Human Papillomavirus Type 16 (hpv-16)/hpv-18 As04-adjuvanted Vaccine Against Incident And Persistent Infection With Nonvaccine Oncogenic Hpv Types Using An Alternative Multiplex Type-specific Pcr Assay For Hpv Dna.

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Flicker perimetry in healthy subjects: influence of age and gender, learning effect and short-term fluctuation

PURPOSE: To determine the mean critical fusion frequency and the short-term fluctuation, to analyze the influence of age, gender, and the learning effect in healthy subjects undergoing flicker perimetry. METHODS: Study 1 - 95 healthy subjects underwent flicker perimetry once in one eye. Mean critical fusion frequency values were compared between genders, and the influence of age was evaluated using linear regression analysis. Study 2 - 20 healthy subjects underwent flicker perimetry 5 times in one eye. The first 3 sessions were separated by an interval of 1 to 30 days, whereas the last 3 sessions were performed within the same day. The first 3 sessions were used to investigate the presence of a learning effect, whereas the last 3 tests were used to calculate short-term fluctuation. RESULTS: Study 1 - Linear regression analysis demonstrated that mean global, foveal, central, and critical fusion frequency per quadrant significantly decreased with age (p<0.05).There were no statistically significant differences in mean critical fusion frequency values between males and females (p>0.05), with the exception of the central area and inferonasal quadrant (p=0.049 and p=0.011, respectively), where the values were lower in females. Study 2 - Mean global (p=0.014), central (p=0.008), and peripheral (p=0.03) critical fusion frequency were significantly lower in the first session compared to the second and third sessions. The mean global short-term fluctuation was 5.06±1.13 Hz, the mean interindividual and intraindividual variabilities were 11.2±2.8% and 6.4±1.5%, respectively. CONCLUSION: This study suggests that, in healthy subjects, critical fusion frequency decreases with age, that flicker perimetry is associated with a learning effect, and that a moderately high short-term fluctuation is expected.