Toward including the effect of manufacturing processes in the pre-estimated losses of the switched reluctance motor

The estimation of losses plays a key role in the process of building any electrical machine. How to estimate those losses while designing any machine; by obtaining the characteristic of the electrical steel from the catalogue and calculate the losses. However, this way is inaccurate since the electrical steel performs several manufacturing processes during the process of building any machine, which affects directly the magnetic property of the electrical steel and accordingly the characteristic of the electrical steel will be affected. That means the B–H curve of the steel that was obtained from the catalogue will be changed. Moreover, during loading and rotating the machine, some important changes occur to the B–H characteristic of the electrical steel such as the stress on the laminated iron. Accordingly, the pre-estimated losses are completely far from the actual losses because they were estimated based on the data of the electrical steel obtained from the catalogue. So in order to estimate the losses precisely significant factors of the manufacturing processes must be included. The paper introduces the systematic estimation of the losses including the effect of one of the manufacturing factors. Similarly, any other manufacturing factor can be included in the pre-designed losses estimations.

Peripubertal orchidectomy transitorily affects age-associated thymic involution in rats

The role of gonadal hormones in induction and, particularly, maintenance/progression of rat thymic involution, which normally starts around puberty, was reassessed by examining the effects of peripubertal orchidectomy on thymic weight and morphometric parameters at different times up to the age of 10 months. Up to 6 months post-castration both thymic weight and cellularity in orchidectomized (Cx) rats were greater than in age-matched control rats, sham Cx (Sx). The increase in thymic cellularity reflected an increase in thymocyte proliferation rate (the proportion of proliferating cells was 18.6 ± 0.7% in 2-month-old Cx (N = 5) vs 13.4 ± 0.3% (N = 5) in age-matched Sx rats) followed by reduced sensitivity to apoptotic signals (apoptotic thymocytes were 9.8 ± 0.9% in 2-month-old Cx (N = 5) vs 15.5 ± 0.3% (N = 5) age-matched Sx rats). However, 9 months post-orchidectomy, neither thymic weight and cellularity nor any of the morphometric parameters analyzed differed between Cx and control rats. The reduction of thymic cellularity in Cx rats to control values may be related to increased sensitivity of their thymocytes to apoptotic signals in culture (72.6 ± 1.2% in 10-month-old vs 9.8 ± 0.9% in 2-month-old Cx rats) followed by reduced responsiveness to proliferative stimuli (14.1 ± 0.2% in 10-month-old vs 18.6 ± 0.7% in 2-month-old Cx rats). Thus, the study indicates that the effects of peripubertal orchidectomy on thymic weight and cellularity, as well as on the main morphometric indices, are long-lasting but not permanent, i.e., that removal of the testes can only postpone but not prevent age-related organ atrophy and consequently functional deterioration of the immune system.

Toluene permeabilization differentially affects F- and P-type ATPase activities present in the plasma membrane of Streptococcus mutans

Streptococcus mutans membrane-bound P- and F-type ATPases are responsible for H+ extrusion from the cytoplasm thus keeping intracellular pH appropriate for cell metabolism. Toluene-permeabilized bacterial cells have long been used to study total membrane-bound ATPase activity, and to compare the properties of ATPase in situ with those in membrane-rich fractions. The aim of the present research was to determine if toluene permeabilization can significantly modify the activity of membrane-bound ATPase of both F-type and P-type. ATPase activity was assayed discontinuously by measuring phosphate release from ATP as substrate. Treatment of S. mutans membrane fractions with toluene reduced total ATPase activity by approximately 80% and did not allow differentiation between F- and P-type ATPase activities by use of the standard inhibitors vanadate (3 µM) and oligomycin (4 µg/mL). Transmission electron microscopy shows that, after S. mutans cells permeabilization with toluene, bacterial cell wall and plasma membrane are severely injured, causing cytoplasmic leakage. As a consequence, loss of cell viability and disruption of H+ extrusion were observed. These data suggest that treatment of S. mutans with toluene is an efficient method for cell disruption, but care should be taken in the interpretation of ATPase activity when toluene-permeabilized cells are used, because results may not reflect the real P- and F-type ATPase activities present in intact cell membranes. The mild conditions used for the preparation of membrane fractions may be more suitable to study specific ATPase activity in the presence of biological agents, since this method preserves ATPase selectivity for standard inhibitors.

Manipulating Greek musical modes and tempo affects perceived musical emotion in musicians and nonmusicians

The combined influence of tempo and mode on emotional responses to music was studied by crossing 7 changes in mode with 3 changes in tempo. Twenty-four musicians aged 19 to 25 years (12 males and 12 females) and 24 nonmusicians aged 17 to 25 years (12 males and 12 females) were required to perform two tasks: 1) listening to different musical excerpts, and 2) associating an emotion to them such as happiness, serenity, fear, anger, or sadness. ANOVA showed that increasing the tempo strongly affected the arousal (F(2,116) = 268.62, mean square error (MSE) = 0.6676, P < 0.001) and, to a lesser extent, the valence of emotional responses (F(6,348) = 8.71, MSE = 0.6196, P < 0.001). Changes in modes modulated the affective valence of the perceived emotions (F(6,348) = 4.24, MSE = 0.6764, P < 0.001). Some interactive effects were found between tempo and mode (F (1,58) = 115.6, MSE = 0.6428, P < 0.001), but, in most cases, the two parameters had additive effects. This finding demonstrates that small changes in the pitch structures of modes modulate the emotions associated with the pieces, confirming the cognitive foundation of emotional responses to music.

Maternal protein restriction affects gene expression and enzyme activity of intestinal disaccharidases in adult rat offspring

This study investigated the consequences of intrauterine protein restriction on the gastrointestinal tract and particularly on the gene expression and activity of intestinal disaccharidases in the adult offspring. Wistar rat dams were fed isocaloric diets containing 6% protein (restricted, n = 8) or 17% protein (control, n = 8) throughout gestation. Male offspring (n = 5-8 in each group) were evaluated at 3 or 16 weeks of age. Maternal protein restriction during pregnancy produced offspring with growth restriction from birth (5.7 ± 0.1 vs 6.3 ± 0.1 g; mean ± SE) to weaning (42.4 ± 1.3 vs 49.1 ± 1.6 g), although at 16 weeks of age their body weight was similar to control (421.7 ± 8.9 and 428.5 ± 8.5 g). Maternal protein restriction also increased lactase activity in the proximal (0.23 ± 0.02vs 0.15 ± 0.02), medial (0.30 ± 0.06vs 0.14 ± 0.01) and distal (0.43 ± 0.07vs 0.07 ± 0.02 U·g-1·min-1) small intestine, and mRNA lactase abundance in the proximal intestine (7.96 ± 1.11vs 2.38 ± 0.47 relative units) of 3-week-old offspring rats. In addition, maternal protein restriction increased sucrase activity (1.20 ± 0.02 vs 0.91 ± 0.02 U·g-1·min-1) and sucrase mRNA abundance (4.48 ± 0.51 vs 1.95 ± 0.17 relative units) in the duodenum of 16-week-old rats. In conclusion, the present study shows for the first time that intrauterine protein restriction affects gene expression of intestinal enzymes in offspring.

Streptozotocin-induced diabetes mellitus affects lysosomal enzymes in rat liver

It has been previously shown that dextran sulfate administered to diabetic rats accumulates in the liver and kidney, and this could be due to a malfunction of the lysosomal digestive pathway. The aim of the present study was to evaluate the expression and activities of lysosomal enzymes that act upon proteins and sulfated polysaccharides in the livers of diabetic rats. Diabetes mellitus was induced by streptozotocin in 26 male Wistar rats (12 weeks old), while 26 age-matched controls received only vehicle. The livers were removed on either the 10th or the 30th day of the disease, weighed, and used to evaluate the activity, expression, and localization of lysosomal enzymes. A 50-60% decrease in the specific activities of cysteine proteases, especially cathepsin B, was observed in streptozotocin-induced diabetes mellitus. Expression (mRNA) of cathepsins B and L was also decreased on the 10th, but not on the 30th day. Sulfatase decreased 30% on the 30th day, while glycosidases did not vary (or presented a transitory and slight decrease). There were no apparent changes in liver morphology, and immunohistochemistry revealed the presence of cathepsin B in hepatocyte granules. The decrease in sulfatase could be responsible for the dextran sulfate build-up in the diabetic liver, since the action of sulfatase precedes glycosidases in the digestive pathway of sulfated polysaccharides. Our findings suggest that the decreased activities of cathepsins resulted from decreased expression of their genes, and not from general lysosomal failure, because the levels of glycosidases were normal in the diabetic liver.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Diabetes mellitus affects the biomechanical function of the callus and the expression of TGF-beta1 and BMP2 in an early stage of fracture healing

Transforming growth factor beta 1 (TGF-β1) and bone morphogenetic protein-2 (BMP-2) are important regulators of bone repair and regeneration. In this study, we examined whether TGF-β1 and BMP-2 expressions were delayed during bone healing in type 1 diabetes mellitus. Tibial fractures were created in 95 diabetic and 95 control adult male Wistar rats of 10 weeks of age. At 1, 2, 3, 4, and 5 weeks after fracture induction, five rats were sacrificed from each group. The expressions of TGF-β1 and BMP2 in the fractured tibias were measured by immunohistochemistry and quantitative reverse-transcription polymerase chain reaction, weekly for the first 5 weeks post-fracture. Mechanical parameters (bending rigidity, torsional rigidity, destruction torque) of the healing bones were also assessed at 3, 4, and 5 weeks post-fracture, after the rats were sacrificed. The bending rigidity, torsional rigidity and destruction torque of the two groups increased continuously during the healing process. The diabetes group had lower mean values for bending rigidity, torsional rigidity and destruction torque compared with the control group (P<0.05). TGF-β1 and BMP-2 expression were significantly lower (P<0.05) in the control group than in the diabetes group at postoperative weeks 1, 2, and 3. Peak levels of TGF-β1 and BMP-2 expression were delayed by 1 week in the diabetes group compared with the control group. Our results demonstrate that there was a delayed recovery in the biomechanical function of the fractured bones in diabetic rats. This delay may be associated with a delayed expression of the growth factors TGF-β1 and BMP-2.

The effects of water and sucrose contents on the physicochemical properties of non-directly expanded rice flour extrudates

Rice flour was processed by extrusion cooking in the presence of variable contents of water and sucrose. The process was carried out in a twin-screw extruder under the conditions given by a centre rotational experimental design of second order. The effects of the independent variables, water content (27.9 to 42.1%), and sucrose content (0.1 to 19.9%) on the physicochemical properties of the extrudates were investigated. The water absorption index (WAI), water solubility index (WSI), volumetric expansion index (VEI), and bulk density (BD) were determined as dependent variables. BD was determined for samples before and after frying. An increase in water contents resulted in higher WAI and VEI, and lower WSI and BD for extrudates before and after frying. Higher sucrose levels led to increased values of WAI and VEI and to reduced values of WSI and BD. Both independent variables had significant influence on the physicochemical properties of rice flour extrudates. However, the sucrose content was the most significant. The interaction between these two independent variables and their quadratic effect were also important for the responses studied.

English L2 Learners’ Speech – And How the Spoken Language Course Affects Its Lexical Richness

Tässä sivuaineen tutkielmassa tarkasteltiin englannin kielen sanaston kehitystä lukion vieraan kielen syventävän suullisen kurssin aikana. Tutkimuksessa selvitettiin, miten oppilaiden sanastollinen rikkaus muuttuu puhutussa kielessä. Sanastollista rikkautta analysoitiin sanastollisen variaation ja sanastollisen tiheyden mittareilla. Työssä hyödynnettiin pitkittäistutkimusasetelmaa eli verrattiin yhden oppilasryhmän puhetta sekä ennen lukion englannin kielen suullista kurssia että sen jälkeen. Osanottajia oli yhteensä yhdeksän, jotka kaikki olivat lukion toisella vuosikurssilla. Osallistujien tekemät suulliset testit olivat osa Turun yliopiston keräämää tutkimuskäyttöön tarkoitettua materiaalia. Äänitteistä tehdyt transkriptiot muokattiin tätä tutkimusta varten sopiviksi, jonka jälkeen niistä mitattiin sanastollista rikkautta erilaisilla mittareilla. Aineistoa tutkittiin määrällisin menetelmin. Tulokset osoittavat, että keskimääräisesti sekä puheen sanastollinen variaatio että sanastollinen tiheys kehittyivät kurssin aikana hiukan. Toisin sanoen oppilaat käyttivät kurssin jälkeen tehdyssä testissä aavistuksen verran monipuolisempaa sanastoa, ja sisältösanojen osuus kieliopillisiin sanoihin nähden oli hieman suurempi kuin ennen kurssia. Kurssin aikana oppilaiden aktiivisessa sanavarastossa tapahtunut kehitys ei kuitenkaan ollut tilastollisesti merkitsevää. Lisäksi tutkimus osoitti, että osallistujien väliset erot olivat suuria, mutta erot tasoittuivat jonkin verran kurssin jälkeen. Tutkimustulosten perusteella voidaan olettaa englannin kielen suullisen kurssin sekä lisänneen oppilaiden sanastollista rikkautta että tasoittaneen yksilöllisiä eroja, yhdessä monien muiden mahdollisten tekijöiden kanssa. Tutkimusotoksen pienuuden vuoksi tuloksia ei kuitenkaan voida yleistää. Jatkossa olisi mielenkiintoista laajentaa tutkimusnäkökulmaa koskemaan muitakin sanastollisen rikkauden osa-alueita kuten sanastollista sofistikaatiota. Olisi myös mielenkiintoista sisällyttää tutkimukseen oppilaiden passsiivisen sanavaraston mittaaminen ja mahdollisesti tutkia englannin kielen suullisen kurssin vaikutuksia oppilaiden suullisen kielitaidon kehittymiseen laajemminkin kuin vain sanavaraston osalta.

Asiakassuhteen johtaminen ja kehityspotentiaalit arvoketjussa

Tämän tutkimuksen tavoitteena oli tehdä ymmärrettäväksi kvalitatiivisen tutkimus-menetelmää käyttäen tutkimuskohteena olevan case -yrityksen myynnin edustaji-en asiakassuhteen johtamisesta sekä sen hoitamisesta tapahtuvia toimia sekä niiden vaikutusta yrityksen arvoketjutoimintoihin ja prosesseihin sekä yrityksen asiakkaisiin. Tutkimuksella haluttiin löytää ne tekijät ja toimet, mitkä vaikuttavat prosessien toimimiseen sekä aiheuttavat suoraan tai välillisesti kustannuksia tai prosessihidasteita yritykselle. Lisäksi halutaan saada käsitys siitä osataanko nämä kohdat tällä hetkellä tiedostaa myynnin ja arvoketju toimesta. Tutkimuksen asiaa tarkastellaan case -yrityksen kolmen liiketoiminta-alueen kannalta. Tutkimuksen teoreettinen viitekehys rakentuu asiakassuhteen johtamisen, asia-kaspalvelun, asiakaspalvelun laadun sekä sisäisen asiakaspalvelun teorioiden ympärille. Lisäksi viitekehyksessä aihetta tarkastellaan kannattavuuden ja proses-sitehokkuuden näkökulmasta. Tutkimus empiirinen osuus toteutettiin puoli strukturoituina teemahaastatteluina valituille myynnin sekä arvoketjun edustajille. Tutkimusosiossa haluttiin saada selvyys sekä näkemys siihen, miten asiakassuhteen johtaminen tällä hetkellä tapahtuu case -yrityksessä sekä mitä tämä vaikuttaa yrityksen arvoketjun prosesseihin kun palveluprossien volyymimäärä on suuri. Tutkimustulokset vahvistavat sen, että yrityksen hyvällä ja sujuvalla yrityksen si-säisellä asiakaspalvelulla oli iso vaikutus yrityksen sisäisiin prosesseihin sekä asiakkaalle tuotettavaan asiakaspalvelun laatuun. Lisäksi toimiva ja sujuva sisäinen asiakaspalvelu vaikuttaa yritykseen myyntiin ja sitä kautta syntyvään tulokseen.

Promoting Healthy Lifestyles with Personalized, APOE Genotype Based Health Information: The Effects on Psychological-, Health Behavioral and Clinical Factors

There is an increasing demand for individualized, genotype-based health advice. The general population-based dietary recommendations do not always motivate people to change their life-style, and partly following this, cardiovascular diseases (CVD) are a major cause of death in worldwide. Using genotype-based nutrition and health information (e.g. nutrigenetics) in health education is a relatively new approach, although genetic variation is known to cause individual differences in response to dietary factors. Response to changes in dietary fat quality varies, for example, among different APOE genotypes. Research in this field is challenging, because several non-modifiable (genetic, age, sex) and modifiable (e.g. lifestyle, dietary, physical activity) factors together and with interaction affect the risk of life-style related diseases (e.g. CVD). The other challenge is the psychological factors (e.g. anxiety, threat, stress, motivation, attitude), which also have an effect on health behavior. The genotype-based information is always a very sensitive topic, because it can also cause some negative consequences and feelings (e.g. depression, increased anxiety). The aim of this series of studies was firstly to study how individual, genotype-based health information affects an individual’s health form three aspects, and secondly whether this could be one method in the future to prevent lifestyle-related diseases, such as CVD. The first study concentrated on the psychological effects; the focus of the second study was on health behavior effects, and the third study concentrated on clinical effects. In the fourth study of this series, the focus was on all these three aspects and their associations with each other. The genetic risk and health information was the APOE gene and its effects on CVD. To study the effect of APOE genotype-based health information in prevention of CVD, a total of 151 volunteers attended the baseline assessments (T0), of which 122 healthy adults (aged 20 – 67 y) passed the inclusion criteria and started the one-year intervention. The participants (n = 122) were randomized into a control group (n = 61) and an intervention group (n = 61). There were 21 participants in the intervention Ɛ4+ group (including APOE genotypes 3/4 and 4/4) and 40 participants in the intervention Ɛ4- group (including APOE genotypes 2/3 and 3/3). The control group included 61 participants (including APOE genotypes 3/4, 4/4, 2/3, 3/3 and 2/2). The baseline (T0) and follow-up assessments (T1, T2, T3) included detailed measurements of psychological (threat and anxiety experience, stage of change), and behavioral (dietary fat quality, consumption of vegetables, - high fat/sugar foods and –alcohol, physical activity and health and taste attitudes) and clinical factors (total-, LDL- HDL cholesterol, triglycerides, blood pressure, blood glucose (0h and 2h), body mass index, waist circumference and body fat percentage). During the intervention six different communication sessions (lectures on healthy lifestyle and nutrigenomics, health messages by mail, and personal discussion with the doctor) were arranged. The intervention groups (Ɛ4+ and Ɛ4-) received their APOE genotype information and health message at the beginning of the intervention. The control group received their APOE genotype information after the intervention. For the analyses in this dissertation, the results for 106/107 participants were analyzed. In the intervention, there were 16 participants in the high-risk (Ɛ4+) group and 35 in the low-risk (Ɛ4-) group. The control group had 55 participants in studies III-IV and 56 participants in studies I-II. The intervention had both short-term (≤ 6 months) and long-term (12 months) effects on health behavior and clinical factors. The short-term effects were found in dietary fat quality and waist circumference. Dietary fat quality improved more in the Ɛ4+ group than the Ɛ4- and the control groups as the personal, genotype-based health information and waist circumference lowered more in the Ɛ4+ group compared with the control group. Both these changes differed significantly between the Ɛ4+ and control groups (p<0.05). A long-term effect was found in triglyceride values (p<0.05), which lowered more in Ɛ4+ compared with the control group during the intervention. Short-term effects were also found in the threat experience, which increased mostly in the Ɛ4+ group after the genetic feedback (p<0.05), but it decreased after 12 months, although remaining at a higher level compared to the baseline (T0). In addition, Study IV found that changes in the psychological factors (anxiety and threat experience, motivation), health and taste attitudes, and health behaviors (dietary, alcohol consumption, and physical activity) did not directly explain the changes in triglyceride values and waist circumference. However, change caused by a threat experience may have affected the change in triglycerides through total- and HDL cholesterol. In conclusion, this dissertation study has given some indications that individual, genotypebased health information could be one potential option in the future to prevent lifestyle-related diseases in public health care. The results of this study imply that personal genetic information, based on APOE, may have positive effects on dietary fat quality and some cardiovascular risk markers (e.g., improvement in triglyceride values and waist circumference). This study also suggests that psychological factors (e.g. anxiety and threat experience) may not be an obstacle for healthy people to use genotype-based health information to promote healthy lifestyles. However, even in the case of very personal health information, in order to achieve a permanent health behavior change, it is important to include attitudes and other psychological factors (e.g. motivation), as well as intensive repetition and a longer intervention duration. This research will serve as a basis for future studies and its information can be used to develop targeted interventions, including health information based on genotyping that would aim at preventing lifestyle diseases. People’s interest in personalized health advices has increased, while also the costs of genetic screening have decreased. Therefore, generally speaking, it can be assumed that genetic screening as a part of the prevention of lifestyle-related diseases may become more common in the future. In consequence, more research is required about how to make genetic screening a practical tool in public health care, and how to efficiently achieve long-term changes.