942 resultados para [day] [water layer with no specific feature]
Resumo:
Five years of SMOS L-band brightness temperature data intercepting a large number of tropical cyclones (TCs) are analyzed. The storm-induced half-power radio-brightness contrast (ΔI) is defined as the difference between the brightness observed at a specific wind force and that for a smooth water surface with the same physical parameters. ΔI can be related to surface wind speed and has been estimated for ~ 300 TCs that intercept with SMOS measurements. ΔI, expressed in a common storm-centric coordinate system, shows that mean brightness contrast monotonically increases with increased storm intensity ranging from ~ 5 K for strong storms to ~ 24 K for the most intense Category 5 TCs. A remarkable feature of the 2D mean ΔI fields and their variability is that maxima are systematically found on the right quadrants of the storms in the storm-centered coordinate frame, consistent with the reported asymmetric structure of the wind and wave fields in hurricanes. These results highlight the strong potential of SMOS measurements to improve monitoring of TC intensification and evolution. An improved empirical geophysical model function (GMF) was derived using a large ensemble of co-located SMOS ΔI, aircraft and H*WIND (a multi-measurement analysis) surface wind speed data. The GMF reveals a quadratic relationship between ΔI and the surface wind speed at a height of 10 m (U10). ECMWF and NCEP analysis products and SMOS derived wind speed estimates are compared to a large ensemble of H*WIND 2D fields. This analysis confirms that the surface wind speed in TCs can effectively be retrieved from SMOS data with an RMS error on the order of 10 kt up to 100 kt. SMOS wind speed products above hurricane force (64 kt) are found to be more accurate than those derived from NWP analyses products that systematically underestimate the surface wind speed in these extreme conditions. Using co-located estimates of rain rate, we show that the L-band radio-brightness contrasts could be weakly affected by rain or ice-phase clouds and further work is required to refine the GMF in this context.
Resumo:
International audience
Resumo:
Turbulent fluctuations in the vicinity of the water free surface along a flat, vertically oriented surface-piercing plate are studied experimentally using a laboratory-scale experiment. In this experiment, a meter-wide stainless steel belt travels horizontally in a loop around two rollers with vertically oriented axes, which are separated by 7.5 meters. This belt device is mounted inside a large water tank with the water level set just below the top edge of the belt. The belt, rollers, and supporting frame are contained within a sheet metal box to keep the device dry except for one 6-meter-long straight test section between rollers. The belt is launched from rest with an acceleration of up to 3-g in order to quickly reach steady state velocity. This creates a temporally evolving boundary layer analogous to the spatially evolving boundary layer created along a flat-sided ship moving at the same velocity, with a length equivalent to the length of belt that has passed the measurement region since the belt motion began. Surface profile measurements in planes normal to the belt surface are conducted using cinematic Laser Induced Fluorescence and quantitative surface profiles are extracted at each instant in time. Using these measurements, free surface fluctuations are examined and the propagation behavior of these free surface ripples is studied. It is found that free surface fluctuations are generated in a region close to the belt surface, where sub-surface velocity fluctuations influence the behavior of these free surface features. These rapidly-changing surface features close to the belt appear to lead to the generation of freely-propagating waves far from the belt, outside the influence of the boundary layer. Sub-surface PIV measurements are performed in order to study the modification of the boundary layer flow field due to the effects of the water free surface. Cinematic planar PIV measurements are performed in horizontal planes parallel to the free surface by imaging the flow from underneath the tank, providing streamwise and wall-normal velocity fields. Additional planar PIV experiments are performed in vertical planes parallel to the belt surface in order to study the bahvior of streamwise and vertical velocity fields. It is found that the boundary layer grows rapidly near the free surface, leading to an overall thicker boundary layer close to the surface. This rapid boundary layer growth appears to be linked to a process of free surface bursting, the sudden onset of free surface fluctuations. Cinematic white light movies are recorded from beneath the water surface in order to determine the onset location of air entrainment. In addition, qualitative observations of these processes are made in order to determine the mechanisms leading to air entrainment present in this flow.
Resumo:
The main problem on the exploration activity on petroleum industry is the formation water resulted on the fields producing. The aggravating of this problem is correlated with the advancing technologies used on the petroleum extractions and on its secondary approach objecting the reobtainment of this oil. Among the main contaminants of the water formation are corrosives gases such as: O2, CO2 and H2S, some solids in suspension and dissolved salts. Concerning to those gases the CO2 is the one that produce significant damage for carbon steel on corrosion process of the petroleum and gas industries. Corrosion inhibitors for carbon steel in formation water is one of the most used agents in control of those damages. In this context, the poor investigations of carbon steel corrosion proceeding from solids in suspension is an opened field for studies. On this work the inhibitor effect of the commercial CORRTREAT 703 was evaluated on some specific solids in suspension at saline medium containing 10.000 ppm of de-aerated chloride using CO2 until non oxygen atmosphere been present. For that, quartz, calcium carbonate, magnetite and iron sulphide were subjected to this investigation as the selected solids. The effect of this inhibitor on corrosion process correlated with those specific solids, was measured using electrochemical (resistance of linear polarization and galvanic pair) and gravimetrical techniques. During all the experimental work important parameters were monitored such as: pH, dissolved oxygen, temperature, instantaneous corrosion rate and galvanic current. According to the obtained results it was proved that the suspension solids calcium carbonate and iron sulphide decrease the corrosion process in higher pH medium. Meanwhile the quartz and magnetite been hardness increase corrosion by broking of the passive layer for erosion. In the other hand, the tested inhibitor in concentration of 50 ppm, showed to be effective (91%) in this corrosion process
Resumo:
Graphene-based nanomaterials are a kind of new technological materials with high interest for physicists, chemists and materials scientists. Graphene is a two-dimensional (2-D) sheet of carbon atoms in a hexagonal configuration with atoms bonded by sp2 bonds. These bonds and this electron configuration provides the extraordinary properties of graphene, such as very large surface area, a tunable band gap, high mechanical strength and high elasticity and thermal conductivity [1]. Graphene has also been investigated for preparation of composites with various semiconductors like TiO2, ZnO, CdS aiming at enhanced photocatalytic activity for their use for photochemical reaction as water splitting or CO2 to methanol conversion [2-3]. In this communication, the synthesis of porous graphene@TiO2 obtained from a powder graphite recycled, supplied by ECOPIBA, is presented. This graphite was exfoliated, using a nonionic surfactant (Triton X-100) and sonication. Titanium(IV) isopropoxide was used as TiO2 source. After removing the surfactant with a solution HCl/n-propanol, a porous solid is obtained with a specific area of 358 m2g-1. The solid was characterized by XRD, FTIR, XPS, EDX and TEM. Figure 1 shows the graphene 2D layer bonded with nanoparticles of TiO2. When a water suspension of this material is exposed with UV-vis radiation, water splitting reaction is carried out and H2/O2 bubbles are observed (Figure 2)
Resumo:
Les zéolithes étant des matériaux cristallins microporeux ont démontré leurs potentiels et leur polyvalence dans un nombre très important d’applications. Les propriétés uniques des zéolithes ont poussé les chercheurs à leur trouver constamment de nouvelles utilités pour tirer le meilleur parti de ces matériaux extraordinaires. Modifier les caractéristiques des zéolithes classiques ou les combiner en synergie avec d’autres matériaux se trouvent être deux approches viables pour trouver encore de nouvelles applications. Dans ce travail de doctorat, ces deux approches ont été utilisées séparément, premièrement avec la modification morphologique de la ZSM-12 et deuxièmement lors de la formation des matériaux de type coeur/coquille (silice mésoporeuses@silicalite-1). La ZSM-12 est une zéolithe à haute teneur en silice qui a récemment attiré beaucoup l’attention par ses performances supérieures dans les domaines de l’adsorption et de la catalyse. Afin de synthétiser la ZSM-12 avec une pureté élevée et une morphologie contrôlée, la cristallisation de la zéolithe ZSM-12 a été étudiée en détail en fonction des différents réactifs chimiques disponibles (agent directeur de structure, types de silicium et source d’aluminium) et des paramètres réactionnels (l’alcalinité, ratio entre Na, Al et eau). Les résultats présentés dans cette étude ont montré que, contrairement à l’utilisation du structurant organique TEAOH, en utilisant un autre structurant, le MTEAOH, ainsi que le Al(o-i-Pr)3, cela a permis la formation de monocristaux ZSM-12 monodisperses dans un temps plus court. L’alcalinité et la teneur en Na jouent également des rôles déterminants lors de ces synthèses. Les structures de types coeur/coquille avec une zéolithe polycristalline silicalite-1 en tant que coquille, entourant un coeur formé par une microsphère de silice mésoporeuse (tailles de particules de 1,5, 3 et 20-45 μm) ont été synthétisés soit sous forme pure ou chargée avec des espèces hôtes métalliques. Des techniques de nucléations de la zéolithe sur le noyau ont été utilisées pour faire croitre la coquille de façon fiable et arriver à former ces matériaux. C’est la qualité des produits finaux en termes de connectivité des réseaux poreux et d’intégrité de la coquille, qui permet d’obtenir une stéréosélectivité. Ceci a été étudié en faisant varier les paramètres de synthèse, par exemple, lors de prétraitements qui comprennent ; la modification de surface, la nucléation, la calcination et le nombre d’étapes secondaires de cristallisation hydrothermale. En fonction de la taille du noyau mésoporeux et des espèces hôtes incorporées, l’efficacité de la nucléation se révèle être influencée par la technique de modification de surface choisie. En effet, les microsphères de silice mésoporeuses contenant des espèces métalliques nécessitent un traitement supplémentaire de fonctionnalisation chimique sur leur surface externe avec des précurseurs tels que le (3-aminopropyl) triéthoxysilane (APTES), plutôt que d’utiliser une modification de surface avec des polymères ioniques. Nous avons également montré que, selon la taille du noyau, de deux à quatre traitements hydrothermaux rapides sont nécessaires pour envelopper totalement le noyau sans aucune agrégation et sans dissoudre le noyau. De tels matériaux avec une enveloppe de tamis moléculaire cristallin peuvent être utilisés dans une grande variété d’applications, en particulier pour de l’adsorption et de la catalyse stéréo-sélective. Ce type de matériaux a été étudié lors d’une série d’expériences sur l’adsorption sélective du glycérol provenant de biodiesel brut avec des compositions différentes et à des températures différentes. Les résultats obtenus ont été comparés à ceux utilisant des adsorbants classiques comme par exemple du gel de sphères de silice mésoporeux, des zéolithes classiques, silicalite-1, Si-BEA et ZSM-5(H+), sous forment de cristaux, ainsi que le mélange physique de ces matériaux références, à savoir un mélange silicalite-1 et le gel de silice sphères. Bien que le gel de sphères de silice mésoporeux ait montré une capacité d’adsorption de glycérol un peu plus élevée, l’étude a révélé que les adsorbants mésoporeux ont tendance à piéger une quantité importante de molécules plus volumineuses, telles que les « fatty acid methyl ester » (FAME), dans leur vaste réseau de pores. Cependant, dans l’adsorbant à porosité hiérarchisée, la fine couche de zéolite silicalite-1 microporeuse joue un rôle de membrane empêchant la diffusion des molécules de FAME dans les mésopores composant le noyau/coeur de l’adsorbant composite, tandis que le volume des mésopores du noyau permet l’adsorption du glycérol sous forme de multicouches. Finalement, cette caractéristique du matériau coeur/coquille a sensiblement amélioré les performances en termes de rendement de purification et de capacité d’adsorption, par rapport à d’autres adsorbants classiques, y compris le gel de silice mésoporeuse et les zéolithes.
Resumo:
Massive proliferations of cyanobacteria in freshwaters have recently increased, causing ecological and economic losses. Their ever-increasing presence in water sources destined to potabilization has become a major threat for public health, since several species can produce harmful toxins (cyanotoxin). Therefore, additional specific measures to improve management and treatment of drinking water(s) are required. The PhD thesis investigates toxic cyanobacteria in drinking waters with a special focus on Emilia-Romagna (Italy), throughout three separated chapters, each with different specific objectives. The first chapter aims at improving the fast monitoring of cyanobacteria in drinking water, which was investigated by testing different models of multi-wavelength spectrofluorometers. Inter-laboratories calibrations were conducted using mono-specific cultures and field samples, and both the feasibility and the technical limitations of such tools were illustrated. The second chapter evaluates the effectiveness of drinking water treatments in removing cyanobacterial cells and toxins. Two chlorinated oxidants (sodium hypochlorite and chlorine dioxide) already in use for pre-oxidation during water potabilization, were tested on cultures of the toxic cyanobacterium Microcystis aeruginosa posing a specific focus on toxin removal and revealing that pre-oxidation can cause the release of toxins and unknown metabolites. Innovative treatments based on non-thermal plasma were also tested, observing an effective and rapid inactivation of cyanobacterial cells. The third chapter presents a study on a cyanobacterium isolated from a drinking water reservoir of Emilia-Romagna and investigated by combining biological, chemical, and genomic methods. Although the strain did not produce any known cyanotoxin, high toxicity of water-extract was observed in bioassays and potential implications for drinking water were discussed. Overall, the PhD thesis offers new insights into toxic cyanobacteria management in drinking water, highlighting best practices for drinking water managers regarding their detection and removal. Additionally, the thesis provides new contributions to the understanding of the freshwater cyanobacteria community in the Emilia-Romagna region.
Resumo:
Through the analysis of some case studies, this thesis aims at exploring translation strategies of humour in advertising. Every day we are surrounded by advertising material which prompts us to buy a certain product. Consequently, translation in this field takes on an importance that goes beyond mere linguistic rendition: the quality of the translation may have economic consequences for the underlying company. To this peculiar situation, some advertisements show an even more specific feature on which this study focuses: humour. Humour in advertising is a rather recent strategy with the great advantage of attracting attention and ensuring a greater impact on potential consumers. As a result, translating humour in advertising becomes an operation to be carried out with great awareness: first of all, it is necessary to know the culture (and not only the language) of the audience to which the advertisement is addressed, in order to preserve the humorous effect and avoid introducing offensive elements, one of the risks that will be discussed in the paper. This thesis begins with a theoretical section, which is divided into four chapters devoted respectively to the history and language of advertising, the history and theories of humour, humour as a strategy in advertising, and the translation of humour in advertising (with particular reference to examples of creative translations that demonstrate a mastery of the language and knowledge of the target culture). The analytical section is entrusted to the fifth chapter, which is dedicated to the analysis of humour-based advertising material. In order to preserve the coherence of the case study, international advertising campaigns of only one product type (beer) were chosen.
Resumo:
To evaluate factors associated with hypertension in Brazilian women of 50 years of age or more. A cross-sectional population based study using self-reports. A total of 622 women were included. The association between sociodemographic, clinical and behavioral factors and the woman's age at the onset of hypertension was evaluated. Data were analyzed according to cumulative continuation rates without hypertension, using the life-table method and considering annual intervals. Next, a Cox multiple regression analysis model was adjusted to analyze the occurrence rates of hypertension according to various predictor variables. Significance level was pre-established at 5% (95% confidence level) and the sampling plan (primary sampling unit) was taken into consideration. Median age at onset of hypertension was 64.3 years. Cumulative continuation rate without hypertension at 90 years was 20%. Higher body mass index (BMI) at 20-30 years of age was associated with a higher cumulative occurrence rate of hypertension over time (coefficient=0.078; p<0.001). Being white was associated with a lower cumulative occurrence rate of hypertension over time (coefficient= -0.439; p=0.003), while smoking >15 cigarettes/day was associated with a higher rate over time (coefficient=0.485; p=0.004). The results of the present study highlight the importance of weight control in young adulthood and of avoiding smoking in preventing hypertension in women aged ≥50 years.
Resumo:
A capillary zone electrophoresis (CE) method was developed for the determination of the biocide 2,2-dibromo-3-nitrilo-propionamide (DBNPA) in water used in cooling systems. The biocide is indirectly determined by CE measurement of the concentration of bromide ions produced by the reaction between the DBNPA and bisulfite. The relationship between the bromide peak areas and the DBNPA concentrations showed a good linearity and a coefficient of determination (R(2)) of 0.9997 in the evaluated concentration range of 0-75 μmol L(-1). The detection and quantification limits for DBNPA were 0.23 and 0.75 μmol L(-1), respectively. The proposed CE method was successfully applied for the analysis of samples of tap water and cooling water spiked with DBNPA. The intra-day and inter-day (intermediary) precisions were lower than 2.8 and 6.2%, respectively. The DBNPA concentrations measured by the CE method were compared to the values obtained by a spectrophotometric method and were found to agree well.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Diabetes in spontaneously hypertensive rats is associated with cortical renal GLUT1 and GLUT2 overexpression. Our objective was to evaluate the effect of the angiotensin-converting enzyme blockade on cortical renal GLUT1 and GLUT2 expression, urinary albumin and urinary TGF-β1. Streptozotocin, 50 mg/kg, or citrate buffer (N = 16) was administered as a single injection into the tail vein in adult spontaneously hypertensive rats (~260 g). Thirty days later, these diabetic spontaneously hypertensive rats received ramipril by gavage: 0.01 mg·kg-1·day-1 (D0.01, N = 14), 1 mg·kg-1·day-1 (D1, N = 9) or water (D, N = 11) for 15 days. Albumin and TGF-β1 (24-h urine), direct arterial pressure, renal tissue angiotensin-converting enzyme activity (fluorometric assay), and GLUT1 and GLUT2 protein levels (Western blot, renal cortex) were determined. Glycemia and glycosuria were higher (P < 0.05) in the diabetic rats compared with controls, but similar between the diabetic groups. Diabetes in spontaneously hypertensive rats lowered renal tissue angiotensin-converting enzyme activity (40%), which was reduced further when higher ramipril doses were used. Diabetes associated with hypertension raised GLUT1 by 28% (P < 0.0001) and GLUT2 by 76% (P = 0.01), and both doses of ramipril equally reduced cortical GLUT1 (D vs D1 and vs D0.01, P ≤ 0.001). GLUT2 levels were reduced in D0.01 (P < 0.05 vs D). Diabetes increased urinary albumin and TGF-β1 urinary excretion, but the 15-day ramipril treatment (with either dose) did not reduce them. In conclusion, ramipril is effective in lowering renal tissue angiotensin-converting enzyme activity, as well as blocking cortical GLUT1 overexpression, which may be beneficial in arresting the development of diabetic nephropathy.
Resumo:
OBJETIVO: Descrever e comparar estudos longitudinais que permitam inferir sobre a influência da creche no estado nutricional de crianças pré-escolares. FONTES DE DADOS: Revisão sistemática de trabalhos científicos publicados entre janeiro de 1990 e dezembro de 2008. Buscaram-se os estudos nas seguintes bases de dados: Lilacs, Scielo e PubMed. Realizou-se também pesquisa manual dos artigos referenciados. A busca ocorreu no período de março de 2008 a junho de 2009, e os descritores utilizados foram: "creche", "estado nutricional", "antropometria", "consumo alimentar", "anemia" e "alimentação escolar". SÍNTESE DOS DADOS: Na primeira etapa do estudo, obtiveram-se 78 artigos, mas somente sete puderam ser incluídos. Os outros 71 não apresentaram dados para contribuir com o objetivo específico deste estudo. Entre os artigos pesquisados na literatura, existem poucos que permitem inferir sobre a influência que a creche pode ter em relação ao estado nutricional de pré-escolares. Contudo, estudos longitudinais têm mostrado a relação causal entre a presença frequente da criança na creche e a melhoria do estado nutricional. CONCLUSÕES: Existe uma relação positiva entre a frequência da criança na creche e a melhoria do estado nutricional.
Resumo:
The feasibility of using constructed wetlands (CWs) for the mitigation of pesticide runoff has been studied in the last decade. However, a lack of related data was verified when subsurface flow constructed wetlands (SSF CWs) are considered for this purpose. In the present work, SSF CWs were submitted to continuous ametryn addition and evaluated during an I I-week period, with the aim of determining the feasibility of these systems for mitigation of contaminated water. Ametryn was not added to one CW cell in order to provide a control for the experiments. Monitoring of treatment performance was executed by standard water quality parameters, ametryn chromatography quantification and macrophyte (Typha latifolia L) nutritional and agronomic property analysis. Results indicated that 39% of the total initially added amount of ametryn was removed, transferred or transformed. Herbicide metabolism and mineralisation were carried out by chemical and biological mechanisms. No statistic differences were observed in nutritional contents found in the T. latifolia crops of the CWs after the experimental period. Moreover, the biomass production (one valuable source of renewable energy) was equal to 3.3 t.ha(-1) (dry matter) in wetland cells. It was concluded that constructed wetland systems are capable of mitigating water contaminated with ametryn, acting as buffer filters between the emission sources and the downstream superficial water bodies.