961 resultados para tobacco BY-2 cells
Resumo:
Among the most common features of highly invasive tumors, such as lung adenocarcinomas (AD) and squamous cell carcinomas (SqCC), is the massive degradation of the extracellular matrix. The remarkable qualitative and quantitative modifications of hyaluronidases (HAases), hyaluronan synthases (HAS), E-cadherin adhesion molecules, and the transforming growth factor β (TGF-β) may favor invasion, cellular motility, and proliferation. We examined HAase proteins (Hyal), HAS, E-cadherin, and TGF-β profiles in lung AD subtypes and SqCC obtained from smokers and non-smokers. Fifty-six patients, median age 64 years, who underwent lobectomy for AD (N = 31) and SqCC (N = 25) were included in the study. HAS-1, -2 and -3, and Hyal-1 and -3 were significantly more expressed by tumor cells than normal and stroma cells (P < 0.01). When stratified according to histologic types, HAS-3 and Hyal-1 immunoreactivity was significantly increased in tumor cells of AD (P = 0.01) and stroma of SqCC (P = 0.002), respectively. Tobacco history in patients with AD was significantly associated with increased HAS-3 immunoreactivity in tumor cells (P < 0.01). Stroma cells of SqCC from non-smokers presented a significant association with HAS-3 (P < 0.01). Hyal, HAS, E-cadherin, and TGF-β modulate a different tumor-induced invasive pathway in lung AD subgroups and SqCC. HAases in resected AD and SqCC were strongly related to the prognosis. Therefore, our findings suggest that strategies aimed at preventing high HAS-3 and Hyal-1 synthesis, or local responses to low TGF-β and E-cadherin, may have a greater impact in lung cancer prognosis.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
Type 2 diabetes mellitus (T2D) is a metabolic disease with inflammation as an important pathogenic background. However, the pattern of immune cell subsets and the cytokine profile associated with development of T2D are unclear. The objective of this study was to evaluate different components of the immune system in T2D patients' peripheral blood by quantifying the frequency of lymphocyte subsets and intracellular pro- and anti-inflammatory cytokine production by T cells. Clinical data and blood samples were collected from 22 men (51.6±6.3 years old) with T2D and 20 nonsmoking men (49.4±7.6 years old) who were matched for age and sex as control subjects. Glycated hemoglobin, high-sensitivity C-reactive protein concentrations, and the lipid profile were measured by a commercially available automated system. Frequencies of lymphocyte subsets in peripheral blood and intracellular production of interleukin (IL)-4, IL-10, IL-17, tumor necrosis factor-α, and interferon-γ cytokines by CD3+ T cells were assessed by flow cytometry. No differences were observed in the frequency of CD19+ B cells, CD3+CD8+ and CD3+CD4+ T cells, CD16+56+ NK cells, and CD4+CD25+Foxp3+ T regulatory cells in patients with T2D compared with controls. The numbers of IL-10- and IL-17-producing CD3+ T cells were significantly higher in patients with T2D than in controls (P<0.05). The frequency of interferon-γ-producing CD3+ T cells was positively correlated with body mass index (r=0.59; P=0.01). In conclusion, this study shows increased numbers of circulating IL-10- and IL-17-producing CD3+ T cells in patients with T2D, suggesting that these cytokines are involved in the immune pathology of this disease.
Resumo:
Addition of L-glutamate caused alkalinization of the medium surrounding Asparagus spreng.ri mesophyll cells. This suggests a H+/L-glutmate symport uptake system for L-glutamate. However stoichiometries of H+/L-glutamate symport into Asparagus cells were much higher than those in other plant systems. Medium alkalinization may also result from a metabolic decarboxylation process. Since L-glutmate is decarboxylated to r-amino butyric acid (SABA) in this system, the origin of medium alkalinization was reconsidered. Suspensions of mechanically isolated and photosyntheically competent Asparagus sprengeri mesophyll cells were used to investigate the H+/L-glutamate symport system, SABA production, GABA transport, and the origin of L-glutamate dependent medium alkalinization. The major results obtained are summarized as follows: 1. L-Glutamate and GABA were the second or third most abundant amino acids in these cells. Cellular concentrations of L-glutamate were 1.09 mM and 1.31 mM in the light and dark, respectively. Those of SABA were 1.23 mM and 1.17 mM in the light and dark, respectively. 2. Asparagine was the most abundant amino acid in xylem sap and comprised 54 to 68 1. of the amino acid pool on a molar basis. GABA was the second most abundant amino acid and represented 10 to 11 1. of the amino acid pool. L-Slutamate was a minor component. 3. A 10 minute incubation with 1 mM L-glutamate increased the production of GABA in the medium by 2,743 7. and 2,241 7. in the light and dark, respectively. 4. L-Glutamate entered the cells prior to decarboxylation. 5. There was no evidence for a H+/GABA symport process • 6. GABA was produced by loss of carbon-1 of L-glutamate. 7. The specific activity of newly synthesized labeled GABA suggests that it is not equilibrated with a storage pool of GABA. 8. The mechanism of GABA efflux appears to be a passive process. 9. The evidence indicates that the origin of L-glutamate dependent medium alkalinization is a H+/L-glutamate symport not an extracellular decarboxylation. The possible role of GABA production in regulating cytoplasmic pH and L-glutamate levels during rapid electrogenic H+/L-glutamate symport is discussed.
Resumo:
Affiliation: Sophie Broussau, Amelie Pilotte & Bernard Massie : Départment de microbiologie et immunologie, Faculté de médecine, Université de Montréal
Resumo:
Les maladies cardiovasculaires (MCV) sont la principale cause de décès dans les pays occidentaux et constituent la principale complication associée au diabète. La lipoprotéine lipase (LPL) est une enzyme clé du métabolisme des lipides et est responsable de l'hydrolyse des lipoprotéines riches en triglycérides (TG). Plusieurs études ont démontré que la LPL sécrétée par les macrophages dans la paroi artérielle est pro-athérogénique. La dysfonction endothéliale caractérise les stades précoces du processus athérosclérotique. Il a été observé qu’un récepteur nouvellement identifié des lipoprotéines de basse densité oxydées (LDLox), le récepteur de type lectine des LDLox (LOX-1), est fortement exprimé dans les lésions athérosclérotiques humaines et dans l’aorte de rats diabétiques, suggérant un rôle clé de LOX-1 dans la pathogénèse de l’athérosclérose diabétique. Au vu du rôle potentiel de la LPL macrophagique et du LOX-1 dans l’athérosclérose associée au diabète de type 2, nous avons évalué la régulation de ces deux molécules pro-athérogéniques par des facteurs métaboliques et inflammatoires augmentés dans le diabète, soit la leptine, l’acide linoléique (LA) et la protéine C-réactive (CRP). Nos résultats démontrent que : 1) Dans les cellules endothéliales aortiques humaines (HAECs), LA augmente l’expression protéique de LOX-1 de façon temps- et dose-dépendante; 2) La pré-incubation de HAECs avec des antioxydants et des inhibiteurs de la NADPH oxydase, de la protéine kinase C (PKC) et du facteur nucléaire-kappa B (NF-kB), inhibe l’effet stimulant de LA sur l’expression protéique de LOX-1; 3) Dans les HAECs traitées avec LA, on observe une augmentation d’expression des isoformes classiques de la PKC; 4) LA augmente de manière significative l’expression génique de LOX-1 ainsi que la liaison des protéines nucléaires extraites des HAECs à la séquence régulatrice NF-kB présente dans le promoteur du gène de LOX-1; 5) LA augmente, via LOX-1, la captation des LDLox par les cellules endothéliales. Pris dans leur ensemble, ces résultats démontrent que LA augmente l’expression endothéliale de LOX-1 in vitro et appuient le rôle clé de LA dans la dysfonction endothéliale associée au diabète. Au vu de nos études antérieures démontrant qu’une expression accrue de LPL macrophagique chez les patients diabétiques de type 2 et que l’augmentation de facteurs métaboliques dans cette maladie, soit l’homocystéine (Hcys), les acides gras et les produits terminaux de glycation (AGE), accroissent l’expression de la LPL macrophagique, nous avons par la suite déterminé l’effet, in vitro, de deux autres facteurs métaboliques et inflammatoires surexprimés dans le diabète, soit la leptine et la CRP, sur l’expression de la LPL macrophagique. Les concentrations plasmatiques de leptine sont élevées chez les patients diabétiques et sont associées à un accroissement des risques cardiovasculaires. Nous avons démontré que : 1) Dans les macrophages humains, la leptine augmente l’expression de la LPL, tant au niveau génique que protéique; 2) L’effet stimulant de la leptine sur la LPL est aboli par la pré-incubation avec un anticorps dirigé contre les récepteurs à la leptine (Ob-R), des inhibiteurs de la PKC et des antioxydants; 3) La leptine augmente l’expression membranaire des isoformes classiques de la PKC et la diminution de l’expression endogène de la PKC, abolit l’effet de la leptine sur l’expression de la LPL macrophagique; 4) Dans les macrophages murins, la leptine augmente le taux de synthèse de la LPL et augmente la liaison de protéines nucléaires à la séquence protéine activée-1 (AP-1) du promoteur du gène de la LPL. Ces observations supportent la possibilité que la leptine puisse représenter un facteur stimulant de la LPL macrophagique dans le diabète. Finalement, nous avons déterminé, in vitro, l’effet de la CRP sur l’expression de la LPL macrophagique. La CRP est une molécule inflammatoire et un puissant prédicteur d’événements cardiovasculaires. Des concentrations élevées de CRP sérique sont documentées chez les patients diabétiques de type 2. Nous avons démontré que : 1) Dans les macrophages humains, la CRP augmente l’expression de la LPL au niveau génique et protéique et la liaison de la CRP aux récepteurs CD32 est nécessaire pour médier ses effets; 2) La pré-incubation de macrophages humains avec des antioxydants, des inhibiteurs de la PKC et de la protéine kinase mitogénique activée (MAPK), prévient l’induction de la LPL par la CRP; 3) La CRP augmente l’activité de la LPL, la génération intracellulaire d’espèces radicalaires oxygénées (ROS), l’expression d’isoformes classiques de la PKC et la phosphorylation des kinases extracellulaires régulées 1/2 (ERK 1/2); 4) Les macrophages murins traités avec la CRP démontrent une augmentation de la liaison des protéines nucléaires à la séquence AP-1 du promoteur du gène de la LPL. Ces données suggèrent que la LPL puisse représenter un nouveau facteur médiant les effets délétères de la CRP dans la vasculopathie diabétique. Dans l’ensemble nos études démontrent le rôle clé de facteurs métaboliques et inflammatoires dans la régulation vasculaire de la LPL et du LOX-1 dans le diabète. Nos données suggèrent que la LPL et le LOX-1 puissent représenter des contributeurs clé de l’athérogénèse accélérée associée au diabète chez l’humain. Mots-clés : athérosclérose, maladies cardiovasculaires, diabète de type 2, macrophage, LPL, cellules endothéliales, LOX-1, stress oxydatif, leptine, LA, CRP.
Resumo:
Notre laboratoire a démontré que la capacité proinflammatoire du vascular endothelial growth factor (VEGF-A165) implique la synthèse endothéliale du facteur d’activation plaquettaire (PAF) via l’activation du récepteur tyrosine kinase homodimérique VEGFR-2/R-2. La synthèse du PAF requiert l’activation de la p38 MAPK et p42/44 MAPK qui activent la phospholipase A2 secrétée de type V (sPLA2-V). Nous avons découvert que la synthèse aigue de prostacycline (PGI2) induite par le VEGF-A165 requiert l’activation des récepteurs hétérodimériques VEGFR-1/R-2. L’activation sélective des récepteurs du VEGF peut donc agir comme balance dans la synthèse de facteurs pro-(PAF) et anti-(PGI2) inflammatoire. Cependant, les tyrosines impliquées dans la transphosphorylation de VEGFR-2/R-2 menant à la synthèse du PAF sont inconnues. Par mutagenèse dirigée, nous avons effectué des transfections transitoires de cellules endothéliales avec des plasmides codant pour le VEGFR-2 dont les tyrosines ciblées ont été remplacées de façon séquentielle par une phénylalanine. Un vecteur vide pcDNA a été utilisé comme contrôle négatif. La stimulation des cellules endothéliales de l’aorte bovine (BAEC) transfectées avec le VEGF-A165 (1nM) pendant 15 minutes augmente la synthèse du PAF de 300%, laquelle était similaire dans les BAEC non transfectées. Dans les BAEC transfectées avec les vecteurs pcDNA codant pour les mutations Y801F, Y1059F, Y1175F et Y1214F, nous avons observé une réduction de 54, 73, 68, et 57% respectivement de la synthèse du PAF induite par le VEGF par rapport au pcDNA témoin. Nos résultats apportent un nouvel aperçu sur le mécanisme par lequel le VEGF induit la synthèse du PAF qui est connu pour sa contribution dans l’activité pro-inflammatoire du VEGF.
Resumo:
Bone morphogenetic protein-2 (BMP-2) has the ability to induce osteoblast differentiation of undifferentiated cells, resulting in the healing of skeletal defects when delivered with a suitable carrier. We have applied a versatile delivery platform comprising a novel composite of two biomaterials with proven track records – apatite and poly(lactic-co-glycolic acid) (PLGA) – to the delivery of BMP-2. Sustained release of this growth factor was tuned with variables that affect polymer degradation and/or apatite dissolution, such as polymer molecular weight, polymer composition, apatite loading, and apatite particle size. The effect of released BMP-2 on C3H10T1/2 murine pluripotent mesenchymal cells was assessed by tracking the expression of osteoblastic makers, alkaline phosphatase (ALP) and osteocalcin. Release media collected over 100 days induced elevated ALP activity in C3H10T1/2 cells. The expression of osteocalcin was also upregulated significantly. These results demonstrated the potential of apatite-PLGA composite particles for releasing protein in bioactive form over extended periods of time.
Resumo:
Transient and continuous recombinant protein expression by HEK cells was evaluated in a perfused monolithic bioreactor. Highly porous synthetic cryogel scaffolds (10ml bed volume) were characterised by scanning electron microscopy and tested as cell substrates. Efficient seeding was achieved (94% inoculum retained, with 91-95% viability). Metabolite monitoring indicated continuous cell growth, and endpoint cell density was estimated by genomic DNA quantification to be 5.2x108, 1.1x109 and 3.5x1010 at day 10, 14 and 18. Culture of stably transfected cells allowed continuous production of the Drosophila cytokine Spätzle by the bioreactor at the same rate as in monolayer culture (total 1.2 mg at d18) and this protein was active. In transient transfection experiments more protein was produced per cell compared with monolayer culture. Confocal microscopy confirmed homogenous GFP expression after transient transfection within the bioreactor. Monolithic bioreactors are thus shown to be a flexible and powerful tool for manufacturing recombinant proteins.
Resumo:
We have investigated the signalling properties of the chemokine receptor, CCR5, using several assays for agonism: stimulation of changes in intracellular Ca2+ or CCR5 internalisation in CHO cells expressing CCR5 or stimulation of [S-35]GTP gamma S binding in membranes of CHO cells expressing CCR5. Four isoforms of the chemokine CCL3 with different amino termini (CCL3, CCL3(2-70), CCL3(5-70), CCL3L1) were tested in these assays in order to probe structure/activity relationships. Each isoform exhibited agonism. The pattern of agonism (potency, maximal effect) was different in the three assays, although the rank order was the same with CCL3L1 being the most potent and efficacious. The data show that the amino terminus of the chemokine is important for signalling. A proline at position 2 (CCL3L1) provides for high potency and efficacy but the isoform with a serine at position 2 (CCL3(2-70)) is as efficacious in some assays showing that the proline is not the only determinant of high efficacy. We also increased the sensitivity of CCR5 signalling by treating cells with sodium butyrate, thus increasing the receptor/G protein ratio. This allowed the detection of a change in intracellular Ca2+ after treatment with CCL7 and Met-RANTES showing that these ligands possess measurable but low efficacy. This study therefore shows that sodium butyrate treatment increases the sensitivity of signalling assays and enables the detection of efficacy in ligands previously considered as antagonists. The use of different assay systems, therefore, provides different estimates of efficacy for some ligands at this receptor. (c) 2006 Elsevier Inc. All rights reserved.
Resumo:
We reported recently that bovine theca interna cells in primary culture express several type-I and type-II receptors for bone morphogenetic proteins (BMPs). The same cells express at least two potential ligands for these receptors (BMP-4 and - 7), whereas bovine granulosa cells and oocytes express BMP-6. Therefore, BMPs of intrafollicular origin may exert autocrine/paracrine actions to modulate theca cell function. Here we report that BMP-4, - 6, and - 7 potently suppress both basal ( P < 0.0001; respective IC50 values, 0.78, 0.30, and 1.50 ng/ml) and LH-induced ( P < 0.0001; respective IC50 values, 5.00, 0.55, and 4.55 ng/ml) androgen production by bovine theca cells while having only a moderate effect on progesterone production and cell number. Semiquantitative RT-PCR showed that all three BMPs markedly reduced steady-state levels of mRNA for P450c17. Levels of mRNA encoding steroidogenic acute regulatory protein, P450scc, and 3 beta-hydroxysteroid dehydrogenase were also reduced but to a much lesser extent. Immunocytochemistry confirmed a marked reduction in cellular content of P450c17 protein after BMP treatment ( P < 0.001). Exposure to BMPs led to cellular accumulation of phosphorylated Smad1, but not Smad2, confirming that the receptors signal via a Smad1 pathway. The specificity of the BMP response was further explored by coincubating cells with BMPs and several potential BMP antagonists, chordin, gremlin, and follistatin. Gremlin and chordin were found to be effective antagonists of BMP-4 and - 7, respectively, and the observation that both antagonists enhanced ( P < 0.01) androgen production in the absence of exogenous BMP suggests an autocrine/paracrine role for theca-derived BMP- 4 and - 7 in modulating androgen production. Collectively, these data indicate that an intrafollicular BMP signaling pathway contributes to the negative regulation of thecal androgen production and that ovarian hyperandrogenic dysfunction could be a result of a defective autoregulatory pathway involving thecal BMP signaling.
Resumo:
Insulin is a prebiotic food ingredient, which suppresses colon tumour growth and development in rats. In the gut lumen, it is fermented to lactic acid and short chain fatty acids (SCFA). Of these, butyrate has suppressing agent activities, but little is known concerning cellular responses to complex fermentation samples. To investigate the effects of fermentation products of insulin on cellular responses related to colon carcinogenesis. Fermentations were performed in anaerobic batch cultures or in a three-stage fermentation model that simulates conditions in colon-segments (proximal, transverse, distal). Substrate was insulin enriched with oligofructose (Raftilose® Synergy1), fermented with probiotics (Bifidobacterium lactis Bb12, Lactobacillus rhamnosus GG), and/or faecal inocula. HT29 or CaCo-2 cells were incubated with supernatants of the fermented samples (2.5%-25% v/v, 24-72 hours). Cellular parameters of survival, differentiation, tumour progression, and invasive growth were determined. Fermentation supernatants derived from probiotics and Synergy1 were more effective than with glucose. The additional fermentation with faecal slurries produced supernatants with lower toxicity, higher SCFA contents, and distinct cellular functions. The supernatant derived from the gut model vessel representing the distal colon, was most effective for all parameters, probably on account of higher butyrate-concentrations. Biological effects of insulin upon colon cells may be mediated not only by growth stimulation of the lactic acid-producing bacteria and/or production of butyrate, but also by other bacteria and products of the gut lumen. These newly reported properties of the supernatants to inhibit growth and metastases in colon tumour cells are important mechanisms of tumour suppression.
Resumo:
We have investigated the signalling properties of the chemokine receptor, CCR5, using several assays for agonism: stimulation of changes in intracellular Ca(2+) or CCR5 internalisation in CHO cells expressing CCR5 or stimulation of [(35)S]GTPgammaS binding in membranes of CHO cells expressing CCR5. Four isoforms of the chemokine CCL3 with different amino termini (CCL3, CCL3(2-70), CCL3(5-70), CCL3L1) were tested in these assays in order to probe structure/activity relationships. Each isoform exhibited agonism. The pattern of agonism (potency, maximal effect) was different in the three assays, although the rank order was the same with CCL3L1 being the most potent and efficacious. The data show that the amino terminus of the chemokine is important for signalling. A proline at position 2 (CCL3L1) provides for high potency and efficacy but the isoform with a serine at position 2 (CCL3(2-70)) is as efficacious in some assays showing that the proline is not the only determinant of high efficacy. We also increased the sensitivity of CCR5 signalling by treating cells with sodium butyrate, thus increasing the receptor/G protein ratio. This allowed the detection of a change in intracellular Ca(2+) after treatment with CCL7 and Met-RANTES showing that these ligands possess measurable but low efficacy. This study therefore shows that sodium butyrate treatment increases the sensitivity of signalling assays and enables the detection of efficacy in ligands previously considered as antagonists. The use of different assay systems, therefore, provides different estimates of efficacy for some ligands at this receptor.
Resumo:
Protein kinase C (PKC) plays a pivotal role in modulating the growth of melanocytic cells in culture. We have shown previously that a major physiological substrate of PKC, the 80 kDa myristoylated alanine-rich C-kinase substrate (MARCKS), can be phosphorylated in quiescent, non-tumorigenic melanocytes exposed transiently to a biologically active phorbol ester, but cannot be phosphorylated in phorbol ester-treated, syngeneic malignant melanoma cells. Despite its ubiquitous distribution, the function of MARCKS in cell growth and transformation remains to be demonstrated clearly. We report here that MARCKS mRNA and protein levels are down-regulated significantly in the spontaneously derived murine B16 melanoma cell line compared with syngeneic normal Mel-ab melanocytes. In contrast, the tumourigenic v-Ha-ras-transfonned melan-ocytic line, LTR Ras 2, showed a high basal level of MARCKS phosphorylation which was not enhanced by treatment of cells with phorbol ester. Furthermore, protein levels of MARCKS in LTR Ras 2 cells were similar to those expressed in Mel-ab melanocytes. However, in four out of six murine tumour cell lines investigated, levels of MARCKS protein were barely detectable. Transfection of B16 cells with a plasmid containing the MARCKS cDNA in the sense orientation produced two neomycin-resistant clones displaying reduced proliferative capacity and decreased anchorage-independent growth compared with control cells. In contrast, transfection with the antisense MARCKS construct produced many colonies which displayed enhanced growth and transforming potential compared with control cells. Thus, MARCKS appears to act as a novel growth suppressor in the spontaneous transformation of cells of melanocyte origin and may play a more general role in the tumour progression of other carcinomas.
Resumo:
Fermented dairy products and their component bacteria have been shown to possess health-promoting functions in consumers and recently have been suggested to reduce the risk of colorectal cancer. Kefir and ayran are two popular fermented milk drinks that have their origins in the Caucasus region of Russia. The present study aimed to evaluate their potential anticancer properties in colon cells in vitro. The comet assay and transepithelial resistance assay were used to assess the effect of kefir and ayran supernatants on genotoxicity of fecal water samples and on intestinal tight junction integrity. Their antioxidant capacity was measured by trolox equivalent antioxidant capacity assay and compared with that of unfermented milk. The results showed that DNA damage induced by 2 of 4 fecal water samples was significantly decreased by kefir and ayran supernatants and with ayran the effect was dose-dependent. However no effect on intestinal tight junctions was observed. The supernatants of kefir and ayran contained high amounts of acetic and lactic acid but only a very small quantity of caproic and butyric acid, and they showed significantly greater antioxidant capacity than milk. These findings suggest kefir and ayran can reduce DNA damage, which might be due to their antioxidant capacities.