970 resultados para tDNA-PCR


Relevância:

20.00% 20.00%

Publicador:

Resumo:

A 42-year-old male complaining of thoracic spine pain was admitted to the hospital for evaluation. An X-ray and computer tomography of the thoracic spine showed spondylodiscitis of the L3 lumbar and L2-L3 intervertebral disk. The tuberculin skin test (PPD) was strongly positive. A radioscopy-guided fine needle aspirate of the affected area was cultured but did not reveal the cause of the disease. Two biopsy attempts failed to reveal the cause of the disease by culturing or by acid-fast-resistant staining (Ziehl Neelsen) of the specimens. A third biopsy also failed to detect the infectious agent by using microbiological procedures, but revealed the presence of a 245-bp amplicon characteristic of the Mycobacterium tuberculosis complex after PCR of the sample. The result demonstrates the efficacy of PCR for the identification of M. tuberculosis in situations in which conventional diagnosis by culturing techniques or direct microscopy is unable to detect the microorganism. Following this result the patient was treated with the antituberculous cocktail composed by rifampicin, pirazinamide and isoniazid during a six-month period. At the end of the treatment the dorsalgia symptoms had disappeared.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Shigella spp are Gram-negative, anaerobic facultative, non-motile, and non-sporulated bacilli of the Enterobacteriaceae family responsible for "Shigellosis" or bacillary dysentery, an important cause of worldwide morbidity and mortality. However, despite this, there are very few epidemiological studies about this bacterium in Brazil. We studied the antibiotic resistance profiles and the clonal structure of 60 Shigella strains (30 S. flexneri and 30 S. sonnei) isolated from shigellosis cases in different cities within the metropolitan area of Campinas, State of São Paulo, Brazil. We used the following well-characterized molecular techniques: enterobacterial repetitive intergenic consensus, repetitive extragenic palindromic, and double-repetitive element-polymerase chain reaction to characterize the bacteria. Also, the antibiotic resistance of the strains was determined by the diffusion disk method. Many strains of S. flexneri and S. sonnei were found to be multi-resistant. S. flexneri strains were resistant to ampicillin in 83.3% of cases, chloramphenicol in 70.0%, streptomycin in 86.7%, sulfamethoxazole in 80.0%, and tetracycline in 80.0%, while a smaller number of strains were resistant to cephalothin (3.3%) and sulfazotrim (10.0%). S. sonnei strains were mainly resistant to sulfamethoxazole (100.0%) and tetracycline (96.7%) and, to a lesser extent, to ampicillin (6.7%) and streptomycin (26.7%). Polymerase chain reaction-based typing supported the existence of specific clones responsible for the shigellosis cases in the different cities and there was evidence of transmission between cities. This clonal structure would probably be the result of selection for virulence and resistance phenotypes. These data indicate that the human sanitary conditions of the cities investigated should be improved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Whole blood samples (N = 295) were obtained from different locations in Amazonas and Sucre States, in Venezuela. Malaria was diagnosed by microscopy, OptiMAL™ and polymerase chain reaction (PCR), with Plasmodium vivax, P. falciparum, and P. malariae being detected when possible. We identified 93 infections, 66 of which were caused by P. vivax, 26 by P. falciparum, and 1 was a mixed infection. No infection caused by P. malariae was detected. The sensitivity and specificity of each diagnostic method were high: 95.7 and 97.9% for microscopy, 87.0 and 97.9% for OptiMAL, and 98.0 and 100% for PCR, respectively. Most samples (72.2%) showed more than 5000 parasites/µL blood. The sensitivity of the diagnosis by microscopy and OptiMAL decreased with lower parasitemia. All samples showing disagreement among the methods were reevaluated, but the first result was used for the calculations. Parasites were detected in the 6 false-negative samples by microscopy after the second examination. The mixed infection was only detected by PCR, while the other methods diagnosed it as P. falciparum (microscopy) or P. vivax (OptiMAL) infection. Most of the false results obtained with the OptiMAL strip were related to the P. falciparum-specific band, including 3 species misdiagnoses, which could be related to the test itself or to genetic variation of the Venezuelan strains. The use of the microscopic method for malaria detection is recommended for its low cost but is very difficult to implement in large scale, population-based studies; thus, we report here more efficient methods suitable for this purpose.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Hereditary hemochromatosis (HH) is a common autosomal disorder of iron metabolism mainly affecting Caucasian populations. Three recurrent disease-associated mutations have been detected in the hemochromatosis gene (HFE): C282Y, H63D, and S65C. Although HH phenotype has been associated with all three mutations, C282Y is considered the most relevant mutation responsible for hemochromatosis. Clinical complications of HH include cirrhosis of the liver, congestive cardiac failure and cardiac arrhythmias, endocrine pancreatic disease, which can be prevented by early diagnosis and treatment. Therefore, a reliable genotyping method is required for presymptomatic diagnosis. We describe the simultaneous detection of the C282Y, H63D and S65C mutations in the hemochromatosis gene by real-time PCR followed by melting curve analysis using fluorescence resonance energy transfer (FRET) probes. The acceptor fluorophore may be replaced by a quencher, increasing multiplex possibilities. Real-time PCR results were compared to the results of sequencing and conventional PCR followed by restriction digestion and detection by agarose gel electrophoresis (PCR-RFLP). Genotypes from 80 individuals obtained both by the conventional PCR-RFLP method and quenched-FRET real-time PCR were in full agreement. Sequencing also confirmed the results obtained by the new method, which proved to be an accurate, rapid and cost-effective diagnostic assay. Our findings demonstrate the usefulness of real-time PCR for the simultaneous detection of mutations in the HFE gene, which allows a reduction of a significant amount of time in sample processing compared to the PCR-RFLP method, eliminates the use of toxic reagents, reduces the risk of contamination in the laboratory, and enables full process automation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Amplification of the MYCN gene in neuroblastomas is a potent biological marker of highly aggressive tumors, which are invariably fatal unless sound clinical management is applied. To determine the usefulness of semi-quantitative differential PCR (SQ-PCR) for accurate quantification of MYCN gene copy number, we evaluated the analytical performance of this method by comparing the results obtained with it for 101 tumor samples of neuroblastoma to that obtained by absolute and relative real-time PCR. Similar results were obtained for 100 (99%) samples, no significant difference was detected between the median log10 MYCN copy number (1.53 by SQ-PCR versus 1.55 by absolute real-time PCR), and the results of the two assays correlated closely (r = 0.8, Pearson correlation; P < 0.001). In the comparison of SQ-PCR and relative real-time PCR, SQ-PCR versus relative real-time PCR concordant results were found in 100 (99%) samples, no significant difference was found in median log10 MYCN copy number (1.53 by SQ-PCR versus 1.27 by relative real-time PCR), and the results of the two assays correlated closely (r = 0.8, Pearson correlation; P < 0.001). These findings indicate that the performance of SQ-PCR was comparable to that of real-time PCR for the amplification and quantification of MYCN copy number. Thus, SQ-PCR can be reliably used as an alternative assay in laboratories without facilities for real-time PCR.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Intestinal tuberculosis (ITB) and Crohn's disease (CD) are granulomatous disorders with similar clinical manifestations and pathological features that are often difficult to differentiate. This study evaluated the value of fluorescent quantitative polymerase chain reaction (FQ-PCR) for Mycobacterium tuberculosis (MTB) in fecal samples and biopsy specimens to differentiate ITB from CD. From June 2010 to March 2013, 86 consecutive patients (38 females and 48 males, median age 31.3 years) with provisional diagnoses of ITB and CD were recruited for the study. The patients' clinical, endoscopic, and histological features were monitored until the final definite diagnoses were made. DNA was extracted from 250 mg fecal samples and biopsy tissues from each patient. The extracted DNA was amplified using FQ-PCR for the specific MTB sequence. A total of 29 ITB cases and 36 CD cases were included in the analysis. Perianal disease and longitudinal ulcers were significantly more common in the CD patients (P<0.05), whereas night sweats, ascites, and circumferential ulcers were significantly more common in the ITB patients (P<0.05). Fecal FQ-PCR for MTB was positive in 24 (82.8%) ITB patients and 3 (8.3%) CD patients. Tissue PCR was positive for MTB in 16 (55.2%) ITB patients and 2 (5.6%) CD patients. Compared with tissue FQ-PCR, fecal FQ-PCR was more sensitive (X2=5.16, P=0.02). We conclude that FQ-PCR for MTB on fecal and tissue samples is a valuable assay for differentiating ITB from CD, and fecal FQ-PCR has greater sensitivity for ITB than tissue FQ-PCR.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The diagnostic usefulness of Ziehl-Neelsen (ZN)-stained sputum smears combined with conventional polymerase chain reaction (ZN/PCR) to amplify IS6110 region DNA extracted from ZN slides was evaluated. The objective was to verify if this association could improve tuberculosis (TB) diagnosis in patients at remote sites. The study was carried out in 89 patients with culture-confirmed pulmonary TB as defined by the Brazilian Manual for TB Treatment. The participants were recruited in a reference unit for TB treatment in Rondônia, a state in the Amazonian area in northern Brazil. ZN, PCR, and culture performed in the sputum samples from these patients were analyzed in different combinations (i.e., ZN plus PCR and ZN plus culture). The prevalence rates of pulmonary TB in these patients were 32.6 and 28.1% considering culture and ZN/PCR, respectively. The sensitivity and specificity of ZN/PCR were 86 and 93%, respectively. ZN/PCR was able to detect more TB cases than ZN alone. This method could offer a new approach for accurate tuberculosis diagnosis, especially in remote regions of the world where culture is not available.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Salmonelose é a infecção bacteriana de origem alimentar mais freqüente no Paraná, Brasil, e os surtos estão associados, principalmente, ao consumo de ovos, carne de aves e derivados. Os objetivos deste trabalho foram identificar os sorovares de Salmonella isolados de carcaças de frango e caracterizá-los molecularmente por REP e ERIC-PCR, assim como identificar os fagotipos de Salmonella Enteriditis. Dos 25 isolados de Salmonella spp. analisados, 18 foram identificados como Enteriditis, 4 como Braenderup, 2 como Worthington e 1 como infantis. Dos 18 isolados de Enteriditis, 14 foram PT4, 2 PT4a, 1 PT7 e 1 RDNC, por se tratar de colônia rugosa. REP-PCR forneceu padrão eletroforético distinto de 10 a 13 bandas distribuídas entre 120 e 2072 pb para cada sorovar diferente testado. A ERIC-PCR mostrou um padrão de 4 a 5 bandas entre 180 e 1000 pb e foi menos discriminativa quando comparada à REP-PCR. Os resultados encontrados confirmaram que a fagotipagem é uma ferramenta útil e discriminativa para o sorovar Enteriditis. Apesar do pequeno número de sorovares testados, os resultados sugerem que a REP-PCR parece ser um método atrativo a ser utilizado no futuro para a discriminação preliminar de sorovares de Salmonella.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The increasing presence of products derived from genetically modified (GM) plants in human and animal diets has led to the development of detection methods to distinguish biotechnology-derived foods from conventional ones. The conventional and real-time PCR have been used, respectively, to detect and quantify GM residues in highly processed foods. DNA extraction is a critical step during the analysis process. Some factors such as DNA degradation, matrix effects, and the presence of PCR inhibitors imply that a detection or quantification limit, established for a given method, is restricted to a matrix used during validation and cannot be projected to any other matrix outside the scope of the method. In Brazil, sausage samples were the main class of processed products in which Roundup Ready® (RR) soybean residues were detected. Thus, the validation of methodologies for the detection and quantification of those residues is absolutely necessary. Sausage samples were submitted to two different methods of DNA extraction: modified Wizard and the CTAB method. The yield and quality were compared for both methods. DNA samples were analyzed by conventional and real-time PCR for the detection and quantification of Roundup Ready® soybean in the samples. At least 200 ng of total sausage DNA was necessary for a reliable quantification. Reactions containing DNA amounts below this value led to large variations on the expected GM percentage value. In conventional PCR, the detection limit varied from 1.0 to 500 ng, depending on the GM soybean content in the sample. The precision, performance, and linearity were relatively high indicating that the method used for analysis was satisfactory.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Coffee is one of the most appreciated drinks in the world. Coffee ground is obtained from the fruit of a small plant that belongs to the genus Coffea. Coffea arabica and Coffea canephora robusta are the two most commercially important species. They are more commonly known as arabica and robusta, respectively. Two-thirds of Coffea arabica plants are grown in South and Central America, and Eastern Africa - the place of origin for this coffee species. Contamination by microorganisms has been a major matter affecting coffee quality in Brazil, mainly due to the harvesting method adopted. Brazilian harvests are based on fruits collected from the ground mixed with those that fall on collection cloths. As the Bacillus cereus bacterium frequently uses the soil as its environmental reservoir, it is easily capable of becoming a contaminant. This study aimed to evaluate the contamination and potential of B. cereus enterotoxin genes encoding the HBL and NHE complexes, which were observed in strains of ground and roasted coffee samples sold in Rio de Janeiro. The PCR (Polymerase Chain Reaction) results revealed high potential of enterotoxin production in the samples. The method described by Speck (1984) was used for the isolation of contaminants. The investigation of the potential production of enterotoxins through isolates of the microorganism was performed using the B. cereus enterotoxin Reverse Passive Latex Agglutination test-kit (BCET-RPLA, Oxoid), according to the manufacturer's instructions. The potential of enterotoxin production was investigated using polymerase chain reaction (PCR) methods for hblA, hblD and hblC genes (encoding hemolysin HBL) and for nheA, nheB and nheC genes (encoding non-hemolytic enterotoxin - NHE). Of all the 17 strains, 100% were positive for at least 1 enterotoxin gene; 52.9% (9/17) were positive for the 3 genes encoding the HBL complex; 35.3% (6/17) were positive for the three NHE encoding genes; and 29.4% (5/17) were positive for all enterotoxic genes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The enterotoxigenic species Staphylococcus aureus, S. hyicus and S. intermedius show very similar characteristics, making their identification through conventional microbiological methods difficult. This study aimed at the development of a Multiplex PCR (mPCR) for the identification of S. aureus, S. intermedius and S. hyicus using the nuc gene as the target sequence. The results obtained suggest that the set of primers used was specific for the three species of Staphylococcus evaluate with a detection limit of 10² CFU.mL-1.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The DNA extraction is a critical step in Genetically Modified Organisms analysis based on real-time PCR. In this study, the CTAB and DNeasy methods provided good quality and quantity of DNA from the texturized soy protein, infant formula, and soy milk samples. Concerning the Certified Reference Material consisting of 5% Roundup Ready® soybean, neither method yielded DNA of good quality. However, the dilution test applied in the CTAB extracts showed no interference of inhibitory substances. The PCR efficiencies of lectin target amplification were not statistically different, and the coefficients of correlation (R²) demonstrated high degree of correlation between the copy numbers and the threshold cycle (Ct) values. ANOVA showed suitable adjustment of the regression and absence of significant linear deviations. The efficiencies of the p35S amplification were not statistically different, and all R² values using DNeasy extracts were above 0.98 with no significant linear deviations. Two out of three R² values using CTAB extracts were lower than 0.98, corresponding to lower degree of correlation, and the lack-of-fit test showed significant linear deviation in one run. The comparative analysis of the Ct values for the p35S and lectin targets demonstrated no statistical significant differences between the analytical curves of each target.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To investigate microbial diversity and identify spoilage bacteria in fresh pork sausages during storage, twelve industrial pork sausages of different trademarks were stored at 4 ºC for 0, 14, 28 and 42 days, 80% relative humidity and packaged in sterile plastic bags. Microbiological analysis was performed. The pH and water activity (a w) were measured. The culture-independent method performed was the Polymerase Chain Reaction - Denaturing Gradient Gel Electrophoresis (PCR-DGGE). The culture-dependent method showed that the populations of mesophilic bacteria and Lactic Acid Bacteria (LAB) increased linearly over storage time. At the end of the storage time, the average population of microorganisms was detected, in general, at the level of 5 log cfu g-1. A significant (P < 0.005) increase was observed in pH and a w values at the end of the storage time. The PCR-DGGE allowed a rapid identification of dominant communities present in sausages. PCR-DGGE discriminated 15 species and seven genera of bacteria that frequently constitute the microbiota in sausage products. The most frequent spoilage bacteria identified in the sausages were Lactobacillus sakei and Brochothrix thermosphacta. The identification of dominant communities present in fresh pork sausages can help in the choice of the most effective preservation method for extending the product shelf-life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The physiochemical and biological properties of honey are directly associated to its floral origin. Some current commonly used methods for identification of botanical origin of honey involve palynological analysis, chromatographic methods, or direct observation of the bee behavior. However, these methods can be less sensitive and time consuming. DNA-based methods have become popular due to their simplicity, quickness, and reliability. The main objective of this research is to introduce a protocol for the extraction of DNA from honey and demonstrate that the molecular analysis of the extracted DNA can be used for its botanical identification. The original CTAB-based protocol for the extraction of DNA from plants was modified and used in the DNA extraction from honey. DNA extraction was carried out from different honey samples with similar results in each replication. The extracted DNA was amplified by PCR using plant specific primers, confirming that the DNA extracted using the modified protocol is of plant origin and has good quality for analysis of PCR products and that it can be used for botanical identification of honey.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.