Relationship Between Lower-limb Muscle Strength And Functional Independence Among Elderly People According To Frailty Criteria: A Cross-sectional Study.

Muscle strength and functional independence are considered to be determinants of frailty levels among elderly people. The aim here was to compare lower-limb muscle strength (LLMS) with functional independence in relation to sex, age and number of frailty criteria, and to ascertain the influence of these variables on elderly outpatients' independence. Quantitative cross-sectional study, in a tertiary hospital. The study was conducted on 150 elderly outpatients of both sexes who were in a cognitive condition allowing oral communication, between October 2005 and October 2007. The following instruments were used: five-times sit-to-stand test (FTSST), Functional Independence Measurement (FIM) and Lawton's Instrumental Activities of Daily Living Scale (IADL). Descriptive, comparative, multivariate, univariate and Cronbach alpha analyses were performed. The mean time taken in the FTSST was 21.7 seconds; the mean score for FIM was 82.2 and for IADL was 21.2; 44.7% of the subjects presented 1-2 frailty criteria and 55.3% > 3 criteria. There was a significant association between LLMS and functional independence in relation to the number of frailty criteria, without homogeneity regarding sex and age. Functional independence showed significant influence from sex and LLMS. Elderly individuals with 1 or 2 frailty criteria presented greater independence in all FTSST scores. The subjects with higher LLMS presented better functional independence.

Bacterial Diversity Assessment In Soil Of An Active Brazilian Copper Mine Using High-throughput Sequencing Of 16s Rdna Amplicons.

Mining activities pose severe environmental risks worldwide, generating extreme pH conditions and high concentrations of heavy metals, which can have major impacts on the survival of organisms. In this work, pyrosequencing of the V3 region of the 16S rDNA was used to analyze the bacterial communities in soil samples from a Brazilian copper mine. For the analysis, soil samples were collected from the slopes (geotechnical structures) and the surrounding drainage of the Sossego mine (comprising the Sossego and Sequeirinho deposits). The results revealed complex bacterial diversity, and there was no influence of deposit geographic location on the composition of the communities. However, the environment type played an important role in bacterial community divergence; the composition and frequency of OTUs in the slope samples were different from those of the surrounding drainage samples, and Acidobacteria, Chloroflexi, Firmicutes, and Gammaproteobacteria were responsible for the observed difference. Chemical analysis indicated that both types of sample presented a high metal content, while the amounts of organic matter and water were higher in the surrounding drainage samples. Non-metric multidimensional scaling (N-MDS) analysis identified organic matter and water as important distinguishing factors between the bacterial communities from the two types of mine environment. Although habitat-specific OTUs were found in both environments, they were more abundant in the surrounding drainage samples (around 50 %), and contributed to the higher bacterial diversity found in this habitat. The slope samples were dominated by a smaller number of phyla, especially Firmicutes. The bacterial communities from the slope and surrounding drainage samples were different in structure and composition, and the organic matter and water present in these environments contributed to the observed differences.

Ant-caterpillar Antagonism At The Community Level: Interhabitat Variation Of Tritrophic Interactions In A Neotropical Savanna.

Ant foraging on foliage can substantially affect how phytophagous insects use host plants and represents a high predation risk for caterpillars, which are important folivores. Ant-plant-herbivore interactions are especially pervasive in cerrado savanna due to continuous ant visitation to liquid food sources on foliage (extrafloral nectaries, insect honeydew). While searching for liquid rewards on plants, aggressive ants frequently attack or kill insect herbivores, decreasing their numbers. Because ants vary in diet and aggressiveness, their effect on herbivores also varies. Additionally, the differential occurrence of ant attractants (plant and insect exudates) on foliage produces variable levels of ant foraging within local floras and among localities. Here, we investigate how variation of ant communities and of traits among host plant species (presence or absence of ant attractants) can change the effect of carnivores (predatory ants) on herbivore communities (caterpillars) in a cerrado savanna landscape. We sampled caterpillars and foliage-foraging ants in four cerrado localities (70-460 km apart). We found that: (i) caterpillar infestation was negatively related with ant visitation to plants; (ii) this relationship depended on local ant abundance and species composition, and on local preference by ants for plants with liquid attractants; (iii) this was not related to local plant richness or plant size; (iv) the relationship between the presence of ant attractants and caterpillar abundance varied among sites from negative to neutral; and (v) caterpillars feeding on plants with ant attractants are more resistant to ant predation than those feeding on plants lacking attractants. Liquid food on foliage mediates host plant quality for lepidopterans by promoting generalized ant-caterpillar antagonism. Our study in cerrado shows that the negative effects of generalist predatory ants on herbivores are detectable at a community level, affecting patterns of abundance and host plant use by lepidopterans. The magnitude of ant-induced effects on caterpillar occurrence across the cerrado landscape may depend on how ants use plants locally and how they respond to liquid food on plants at different habitats. This study enhances the relevance of plant-ant and ant-herbivore interactions in cerrado and highlights the importance of a tritrophic perspective in this ant-rich environment.

Toxicity Of Fungal-generated Silver Nanoparticles To Soil-inhabiting Pseudomonas Putida Kt2440, A Rhizospheric Bacterium Responsible For Plant Protection And Bioremediation.

Silver nanoparticles have attracted considerable attention due to their beneficial properties. But toxicity issues associated with them are also rising. The reports in the past suggested health hazards of silver nanoparticles at the cellular, molecular, or whole organismal level in eukaryotes. Whereas, there is also need to examine the exposure effects of silver nanoparticle to the microbes, which are beneficial to humans as well as environment. The available literature suggests the harmful effects of physically and chemically synthesised silver nanoparticles. The toxicity of biogenically synthesized nanoparticles has been less studied than physically and chemically synthesised nanoparticles. Hence, there is a greater need to study the toxic effects of biologically synthesised silver nanoparticles in general and mycosynthesized nanoparticles in particular. In the present study, attempts have been made to assess the risk associated with the exposure of mycosynthesized silver nanoparticles on a beneficial soil microbe Pseudomonas putida. KT2440. The study demonstrates mycosynthesis of silver nanoparticles and their characterisation by UV-vis spectrophotometry, FTIR, X-ray diffraction, nanosight LM20 - a particle size distribution analyzer and TEM. Silver nanoparticles obtained herein were found to exert the hazardous effect at the concentration of 0.4μg/ml, which warrants further detailed investigations concerning toxicity.

Relationship Between Aerobic And Anaerobic Parameters From 3-minute All-out Tethered Swimming And 400-m Maximal Front Crawl Effort.

The main aim of this investigation was to verify the relationship of the variables measured during a 3-minute all-out test with aerobic (i.e., peak oxygen uptake [(Equation is included in full-text article.)] and intensity corresponding to the lactate minimum [LMI]) and anaerobic parameters (i.e., anaerobic work) measured during a 400-m maximal performance. To measure force continually and to avoid the possible influences caused by turns, the 3-minute all-out effort was performed in tethered swimming. Thirty swimmers performed the following tests: (a) a 3-minute all-out tethered swimming test to determine the final force (equivalent to critical force: CF3-MIN) and the work performed above CF3-MIN (W'3-MIN), (b) a LMI protocol to determine the LMI during front crawl swimming, and (c) a 400-m maximal test to determine the (Equation is included in full-text article.)and total anaerobic contribution (WANA). Correlations between the variables were tested using the Pearson's correlation test (p ≤ 0.05). CF3-MIN (73.9 ± 13.2 N) presented a high correlation with the LMI (1.33 ± 0.08 m·s; p = 0.01) and (Equation is included in full-text article.)(4.5 ± 1.2 L·min; p = 0.01). However, the W'3-MIN (1,943.2 ± 719.2 N·s) was only moderately correlated with LMI (p = 0.02) and (Equation is included in full-text article.)(p = 0.01). In summary, CF3-MIN determined during the 3-minute all-out effort is associated with oxidative metabolism and can be used to estimate the aerobic capacity of swimmers. In contrast, the anaerobic component of this model (W'3-MIN) is not correlated with WANA.

Convergence Of Soil Nitrogen Isotopes Across Global Climate Gradients.

Quantifying global patterns of terrestrial nitrogen (N) cycling is central to predicting future patterns of primary productivity, carbon sequestration, nutrient fluxes to aquatic systems, and climate forcing. With limited direct measures of soil N cycling at the global scale, syntheses of the (15)N:(14)N ratio of soil organic matter across climate gradients provide key insights into understanding global patterns of N cycling. In synthesizing data from over 6000 soil samples, we show strong global relationships among soil N isotopes, mean annual temperature (MAT), mean annual precipitation (MAP), and the concentrations of organic carbon and clay in soil. In both hot ecosystems and dry ecosystems, soil organic matter was more enriched in (15)N than in corresponding cold ecosystems or wet ecosystems. Below a MAT of 9.8°C, soil δ(15)N was invariant with MAT. At the global scale, soil organic C concentrations also declined with increasing MAT and decreasing MAP. After standardizing for variation among mineral soils in soil C and clay concentrations, soil δ(15)N showed no consistent trends across global climate and latitudinal gradients. Our analyses could place new constraints on interpretations of patterns of ecosystem N cycling and global budgets of gaseous N loss.

Mineral Nutrition Of Campos Rupestres Plant Species On Contrasting Nutrient-impoverished Soil Types.

In Brazil, the campos rupestres occur over the Brazilian shield, and are characterized by acidic nutrient-impoverished soils, which are particularly low in phosphorus (P). Despite recognition of the campos rupestres as a global biodiversity hotspot, little is known about the diversity of P-acquisition strategies and other aspects of plant mineral nutrition in this region. To explore nutrient-acquisition strategies and assess aspects of plant P nutrition, we measured leaf P and nitrogen (N) concentrations, characterized root morphology and determined the percentage arbuscular mycorrhizal (AM) colonization of 50 dominant species in six communities, representing a gradient of soil P availability. Leaf manganese (Mn) concentration was measured as a proxy for carboxylate-releasing strategies. Communities on the most P-impoverished soils had the highest proportion of nonmycorrhizal (NM) species, the lowest percentage of mycorrhizal colonization, and the greatest diversity of root specializations. The large spectrum of leaf P concentration and variation in root morphologies show high functional diversity for nutritional strategies. Higher leaf Mn concentrations were observed in NM compared with AM species, indicating that carboxylate-releasing P-mobilizing strategies are likely to be present in NM species. The soils of the campos rupestres are similar to the most P-impoverished soils in the world. The prevalence of NM strategies indicates a strong global functional convergence in plant mineral nutrition strategies among severely P-impoverished ecosystems.

Teores de nutrientes na alface irrigada com água residuária aplicada por sistemas de irrigação

A trial was carried out to evaluate the chemical composition in the aerial part of lettuce, cv. 'Elisa', irrigated with wastewater treated with constructed wetland and source deposit water, grown on a Rhodic Hapludox Soil, using the irrigation systems sprinkle, subsurface drip and surface drip irrigation. The experiment was carried out from August 17th to October 3rd of 2001 and the chemical analyses of the lettuce were accomplished to 47 days after transplanting of the seedling. The aerial part of the lettuce was analyzed as for the levels of total nitrogen, nitrate, phosphorus, potassium, calcium, magnesium, sulfur, iron, manganese, copper, zinc, sodium, boron, cobalt and molybdenum. The sodium and the sulfur presented higher levels than the maximum suitable in the aerial part of the lettuce and the smallest level of magnesium, while other chemical elements analyzed were normal and appropriate considering the standard for well-nourished plants, not being influenced by the water type. The sodium was the chemical element that presented the highest levels in the aerial part of the lettuce in the treatments irrigated with wastewater, presenting significant difference in relationship to the treatments irrigated with source deposit water in the three irrigation systems. The use of the different irrigation systems by the application of wastewater treated with constructed wetland did not interfere in the levels of nutrients in the aerial part of the lettuce.

The relationship between physical aspects of quality of life and extreme levels of regular physical activity in adults

This study aimed to check for any significant differences in perceived quality of life, specifically aspects of a physical nature, among volunteers who are more physically active and those less physically active in a university community. The sample consisted of 1,966 volunteers in a university community in Brazil. To assess physical activity levels, volunteers responded to the International Physical Activity Questionnaire (IPAQ), and to analyse the perception of quality of life they responded to WHOQOL-bref, which is classified into three groups according to level of physical activity, taking into account the metabolic equivalent index (MET) over a full week. For comparison, consideration was given to the first and third tertiles, respectively, namely groups of more and less active students. The results indicated that individuals who engaged in more physical activity had a more positive perception of quality of life compared to those who were less active in physical aspects related to the ability to work, energy for day-to-day activities and locomotion.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Imigrantes bolivianos em São Paulo : a Praça Kantuta e o futebol

Universidade Estadual de Campinas . Faculdade de Educação Física

Relationship between periodontitis and rheumatoid arthritis and the effect of non-surgical periodontal treatment

This study analyzed the association of periodontal disease (PD) and rheumatoid arthritis (RA). Seventy-five 35-60-year-old patients were assigned to 5 groups according to the presence (+) or not (-) of PD and RA and the treatment received (TR+) or not (TR-) for PD. Group 3 uses total prosthesis (TP). Clinical and laboratory evaluations were performed at baseline, 3 and 6 months of follow-up by probing pocket depth, bleeding on probing and plaque index for PD, HAQ, DAS28, SF-36 and laboratory: AAG, ESR, CRP for RA. Statistically significant differences for PD after 3 (p=0.0055) and after 6 months (p=0.0066) were obtained in Group 1 (RA+PD+TR+) and 2(RA+PD+TR-); significant reduction in the % of BOP after 6 months (p=0.0128) and significant reduction in the % of Pl after 3 (p=0.0128) and 6 months (p=0.0002) in Group 1. Statistically significant differences between Groups 1 and 3 (RA+TP) for DAS28 at baseline and after 3 months were observed, but not after 6 months. No other parameters for RA were significantly affected. The relationship between RA and PD disease activities is not clear, but the importance of periodontal treatment in the control of inflammation to avoid tooth extraction is evident.

Relationship between oral health and its impact on quality of life among adolescents

The aim of this study was to assess oral health status and its relationship with quality of life. A household population, cross-sectional study was carried out; participants were between 15 and 17 years of age (n = 247) and were examined by two calibrated dentists. Socio-economic status was classified according to ANEP-ABIPEME criteria. Clinical examinations to observe DMFT, CPI and Dean indices were performed as per WHO criteria. The Significant Caries Index (SiC) was used to evaluate polarization of the occurrence of caries among participants of the tercile with higher DMF-T. The OHIP instrument was used to measure quality of life. The Spearman and Mann-Whitney tests were used for assessing correlations (5% significance level). Examinations were carried out in 117 (47.37%) females and in 130 (52.63%) males. Of the examined participants, 45.75% were classified as belonging to socio-economic class C. Caries occurrence was observed in 218 subjects (88.26%); the mean DMFT was 5.40. The SiC index was 9.97. Almost half (47.77%) of the participants examined did not present sextants affected by periodontal disease. Of the participants examined, 80.16% presented absence of fluorosis. The mean OHIP was 3.95. The following correlations were observed: a positive and statistically significant correlation between the highest score in the OHIP and decayed teeth; a positive correlation with threshold significance between OHIP and DMFT; an inverse correlation between intact teeth and OHIP; and a positive and non statistically significant correlation between SiC and OHIP (correlation coefficient = 0.13, p = 0.245). Association between the mean OHIP and the terciles was not significant (p = 0.146); there were also no associations between periodontal condition and OHIP nor were there associations between the presence of fluorosis and mean OHIP.

Relationship among malocclusion, number of occlusal pairs and mastication

This study evaluated the relationship among malocclusion, number of occlusal pairs, masticatory performance, masticatory time and masticatory ability in completely dentate subjects. Eighty healthy subjects (mean age = 19.40 ± 4.14 years) were grouped according to malocclusion diagnosis (n = 16): Class I, Class Class II-2, Class III and Normocclusion (control). Number of occlusal pairs was determined clinically. Masticatory performance was evaluated by the sieving method, and the time used for the comminute test food was registered as the masticatory time. Masticatory ability was measured by a dichotomic self-perception questionnaire. Statistical analysis was done by one-way ANOVA, ANOVA on ranks, Chi-Square and Spearman tests. Class II-1 and III malocclusion groups presented a smaller number of occlusal pairs than Normocclusion (p < 0.0001), Class I (p < 0.001) and II-2 (p < 0.0001) malocclusion groups. Class I, and III malocclusion groups showed lower masticatory performance values compared to Normocclusion (p < 0.05) and Class II-2 (p < 0.05) malocclusion groups. There were no differences in masticatory time (p = 0.156) and ability (χ2 = 3.58/p= 0.465) among groups. Occlusal pairs were associated with malocclusion (rho = 0.444/p < 0.0001) and masticatory performance (rho = 0.393/p < 0.0001), but malocclusion was not correlated with masticatory performance (rho = 0.116/p= 0.306). In conclusion, masticatory performance and ability were not related to malocclusion, and subjects with Class I, II-1 and III malocclusions presented lower masticatory performance because of their smaller number of occlusal pairs.

Bottle feeding, increased overjet and Class 2 primary canine relationship: is there any association?

The aim of this study was to investigate the association between bottle feeding and prevalence rates of increased overjet and Class 2 primary canine relationship. The sample consisted of 911 children (461 boys, 450 girls) aged 3 (13.9%), 4 (40.8%), 5 (34%) and 6 (11.3%) years, with complete primary dentition. Information about nutritive and nonnutritive (pacifier and/or digit) sucking habits was collected through questionnaires. Three calibrated dentists (κ: 0.9-1.0 and Rs > 0.90) performed the clinical assessments. The children were divided into four groups: G1 - not bottle-fed; G2 - exclusively bottle-fed; G3 - breast- and bottle-fed, bottle feeding ceased before 3 years of age; and G4 - breast- and bottle-fed, bottle feeding ceased between 3 and 4 years of age. Associations between nutritive and nonnutritive sucking behaviors and the malocclusions studied were analyzed by multiple binary logistic regression (α= 0.05). The frequencies of increased overjet were: 25.3% (G1), 38.8% (G2), 39.2% (G3) and 47.8% (G4). The percentages of Class 2 canine relationship were: 27.9% (G1), 48.8% (G2), 43.4% (G3) and 43% (G4). No significant effect of bottle feeding was found. The chances of diagnosing increased overjet (O.R. = 4.42, p < 0.001) and Class 2 canine relationship (O.R. = 4.02, p < 0.001) were greater for children with pacifier and/or digit-sucking habits, compared to those without a history of nonnutritive sucking behavior. It may be suggested that bottle feeding alone is not directly associated with higher prevalence rates of increased overjet and Class 2 canine relationship in the primary dentition.