Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Genetic population structure of the catadromous perciform: Macquaria novemaculeata (Percichthyidae)

Genetic population structure in the catadromous Australian bass Macquaria novemaculeata was investigated using samples from four locations spanning 600 km along the eastern Australian coastline. Both allozymes and mtDNA control region sequences were examined. Population subdivision estimates based on allozymes revealed low levels of population structuring (G(st)=0.043, P<0.05). However, mtDNA indicated moderate levels of geographic population structure (G(st)=0.146, P<0.01). Phylogenetic analysis of mtDNA control region sequences (mean sequence divergence 1.9%) indicated little phylogeographic structuring. Results suggested that genotypic variation within each river population, while bring affected primarily by genetic drift, was also prevented from more significant divergence by homogenizing levels of gene flow-synonymous with a one-dimensional stepping-stone model of population structure. The catadromous life history of Macquaria novemaculeata was considered to br influential on the pattern of population structure displayed. Results were compared to the few population genetic studies involving catadromous fishes, indicating that catadromy alone is unlikely to be a good predictor of population structure. A more comprehensive suite of biological characteristics than simple life-history traits must be considered fully to allow reliable predictive models of population structure to be formulated. (C) 1997 The Fisheries Society of the British Isles.

The myosin-I-binding protein Acan125 binds the SH3 domain and belongs to the superfamily of leucine-rich repeat proteins

The SH3 domains of src and other nonreceptor tyrosine kinases have been shown to associate with the motif PXXP, where P and X stand for proline and an unspecified amino acid, but a motif that binds to the SH3 domain of myosin has thus far not been characterized. We previously showed that the SH3 domain of Acanthamoeba myosin-IC interacts with the protein Acan125. We now report that the Acan125 protein sequence contains two tandem consensus PXXP motifs near the C terminus. To test for binding, we expressed a polypeptide, AD3p, which includes 344 residues of native C-terminal sequence and a mutant polypeptide, AD3 Delta 977-994p, which lacks the sequence RPKPVPPPRGAKPAPPPR containing both PXXP motifs. The SH3 domain of Acanthamoeba myosin-IC bound AD3p and not AD3 Delta 977-994p, showing that the PXXP motifs are required for SH3 binding. The sequence of Acan125 is related overall to a protein of unknown function coded by Caenorhabditis elegans gene K07G5.1. The K07G5.1 gene product contains a proline-rich segment similar to the SH3 binding motif found in Acan125. The aligned sequences show considerable conservation of leucines and other hydrophobic residues, including the spacing of these residues, which matches a motif for leucine-rich repeats (LRRs). LRR domains have been demonstrated to be sites for ligand binding. Having an LRR domain and an SH3-binding domain, Acan125 and the C. elegans homologue define a novel family of bifunctional binding proteins.

Derivation and external validation of a simple prediction model for the diagnosis of type 2 Diabetes Mellitus in the Brazilian urban population

A risk score model was developed based in a population of 1,224 individuals from the general population without known diabetes aging 35 years or more from an urban Brazilian population sample in order to select individuals who should be screened in subsequent testing and improve the efficacy of public health assurance. External validation was performed in a second, independent, population from a different city ascertained through a similar epidemiological protocol. The risk score was developed by multiple logistic regression and model performance and cutoff values were derived from a receiver operating characteristic curve. Model`s capacity of predicting fasting blood glucose levels was tested analyzing data from a 5-year follow-up protocol conducted in the general population. Items independently and significantly associated with diabetes were age, BMI and known hypertension. Sensitivity, specificity and proportion of further testing necessary for the best cutoff value were 75.9, 66.9 and 37.2%, respectively. External validation confirmed the model`s adequacy (AUC equal to 0.72). Finally, model score was also capable of predicting fasting blood glucose progression in non-diabetic individuals in a 5-year follow-up period. In conclusion, this simple diabetes risk score was able to identify individuals with an increased likelihood of having diabetes and it can be used to stratify subpopulations in which performing of subsequent tests is necessary and probably cost-effective.

Novel gene containing multiple epidermal growth factor-like motifs transiently expressed in the papillae of the ascidian tadpole larvae

We have investigated molecular mechanisms of the embryonic development of an ascidian, a primitive chordate which shares features of both invertebrates and vertebrates, with a view to identifying genes involved in development and metamorphosis, We isolated 12 partial cDNA sequences which were expressed in a stage-specific manner using differential display, We report here the isolation of a full-length cDNA sequence for one of these genes which was specifically expressed during the tailbud and larval stages of ascidian development, This cDNA, 1213 bp in length, is predicted to encode a protein of 337 amino acids containing four epidermal growth factor (EGF)-like repeats and three novel cysteine-rich repeats, Characterization of its spatial expression pattern by in situ hybridisation in late tailbud and larval embryos demonstrated strong expression localised throughout the papillae and anteriormost trunk and weaker expression in the epidermis of the remainder of the embryo, As recent evidence indicates that the signal for metamorphosis originates in the anterior trunk region, these results suggest that this gene may have a role in signalling the initiation of metamorphosis. (C) 1997 Wiley-Liss, Inc.

Relative Bioavailability of Two Oral Formulations of Risperidone 2 mg: A Single-Dose, Randomized-Sequence, Open-Label, Two-Period Crossover Comparison in Healthy Brazilian Volunteers

Background: Risperidone (RSP) is a benzisoxazole antipsychotic agent used to treat schizophrenia and other psychiatric illnesses in adults and children (including those with autism). After oral administration, RSP is completely absorbed from the gastrointestinal tract and undergoes hydroxylation to yield 9-hydroxyrisperidone (9-OH-RSP), an active metabolite that has a pharmacologic profile and potency similar to RSP. Objectives: The aims of this study were to compare the relative bioavailability of a pharmaceutical-equivalent (test) formulation with a reference formulation of oral RSP 2 mg, both available commercially on the Brazilian pharmaceutical market, and to generate data regarding the oral bioavailability of the tested drug in healthy Brazilian volunteers. Methods: This single-dose, randomized-sequence, open-label, 2-period crossover study was conducted in healthy Brazilian volunteers from August to December 2008. Subjects were randomly assigned to receive the test formulation followed by the reference formulation or vice versa, with a 30-day washout period between doses. Study drugs were administered after a 12-hour overnight fast. For pharmacokinetic analysis, blood samples were drawn at 0 (baseline), 0.25, 0.5, 1, 1.5, 3, 5, 8, 12, 24, 48, 72, 96, and 120 hours after administration. Plasma concentrations of RSP and 9-OH-RSP were determined using LC-MS/MS. The test and reference formulations were to be considered bioequivalent if the 90% CIs for the geometric mean test/reference ratios were within a predetermined range of 80% to 125%, in accordance with the policies of the Brazilian Sanitary Surveillance Agency and the US Food and Drug Administration. Tolerability was determined using clinical assessments, monitoring of vital signs, analysis of laboratory test results, and subject interviews regarding adverse events. Results: A total of 22 subjects were enrolled (11 men, 11 women; mean [SD] age, 32 [12] years [range, 18-58 years]; weight, 70.4 [11.9] kg [range, 50-103 kg]; height, 1.67 [0.08] m [range, 1.56-1.80 m]; and body mass index, 25 [4] kg/m(2) [range, 18-29 kg/m(2)]). For RSP, mean (SD) C(max) values were 12.6 (2.7) and 16.0 (2.3) ng/mL for the test and reference formulations, respectively. For 9-OH-RSP, mean C(max) values were 17.8 (1.3) and 21.0 (1.7) ng/mL for the test and reference formulations. The 90% CIs for the mean test/reference ratios for RSP C(max), AUC(0-120), and AUC(0-infinity) were 74% to 82%, 75% to 85%, and 76% to 85%, respectively, and 83% to 87%, 75% to 79%, and 75% to 78% for 9-OH-RSP. The related adverse events (headache, low back pain, drowsiness, standing hypotension, local postvenipuncture ecchymoses, insomnia, nausea, and vomiting) were transient and mild. Conclusions: This single-dose study found that the test and reference formulations of oral RSP 2 mg did not meet the Brazilian and US regulatory criteria for bioequivalence in these fasting, healthy volunteers. The study formulations appeared to be well tolerated. (Clin Ther 2010;32:2106-2115) (C) 2010 Elsevier HS Journals, Inc.

Lack of Association Between a 3 ` UTR VNTR Polymorphism of Dopamine Transporter Gene (SLC6A3) and ADHD in a Brazilian Sample of Adult Patients

Objective: To investigate a possible association between a 3`UTR VNTR polymorphism of the dopamine transporter gene (SLC6A3) and ADHD in a Brazilian sample of adult patients. Method: Study Case-control with 102 ADHD adult outpatients (DSM-IV criteria) and 479 healthy controls. The primers` sequence used were: 3`UTR-Forward: 5`TGT GGT GAT GGG AAC GGC CTG AG 3` and 3`UTR-Reverse: 5`CTT CCT GGA GGT CAC GGC TCA AGG 3`. Alleles of the 3`UTR were coded according to their number of repeats: 6- repeat 320 bp (allele 6), 8- repeat 400 bp (allele 8), 9-repeat 480 bp (allele 9), 10- repeat 480 bp (allele 10), and 11- repeat 520 bp (allele 11). Results: There were no allelic (chi(2) = 2.67, 5df, p = .75) and genotypic (chi(2) = 7.20, 1df, p = .61) association between adult ADHD and VNTR 3`UTR polymorphism of SLC6A3. Conclusion: Our findings do not support SLC6A3 as marker genetic susceptibility factor in adult ADHD. More comprehensive polymorphism coverage within the SLC6A3 region should be conducted in larger samples, including comparisons in clinical subgroups, and in samples with different ethnic backgrounds. (J. of Att. Dis. 2011; 15(4) 305-309)

Frontal Assessment Battery (FAB) is a simple tool for detecting executive deficits in chronic cannabis users

Background: Cannabis is the most used illicit drug in the world, and its use has been associated with prefrontal cortex (PFC) dysfunction, including deficits in executive functions (EF). Considering that EF may influence treatment outcome, it would be interesting to have a brief neuropsychological battery to assess EF in chronic cannabis users (CCU). In the present study, the Frontal Assessment Battery (FAB), a brief, easy to use neuropsychological instrument aimed to evaluate EF, was used to evaluate cognitive functioning of CCU. Methods: We evaluated 107 abstinent CCU with the FAB and compared with 44 controls matched for age, estimated IQ, and years of education. Results: CCU performed poorly as compared to controls (FAB total score = 16.53 vs. 17.09, p .05). CCU had also a poor performance in the Motor Programming subtest (2.47 vs. 2.73, p .05). Conclusion: This study examined effects of cannabis in executive functioning and showed evidence that the FAB is sensitive to detect EF deficits in early abstinent chronic cannabis users. Clinical significance of these findings remains to be investigated in further longitudinal studies. FAB may be useful as a screening instrument to evaluate the necessity for a complete neuropsychological assessment in this population.

The ceja-1 sequence as a potential new molecular marker for Paracoccidioides brasiliensis infection

P>We have developed a two-step PCR assay that amplifies a region of the ceja-1 sequence that is specific for virulent strains of Paracoccidioides brasiliensis. An internal region of the ceja-1 sequence was chosen for designing primers that were utilised in a single tube heminested PCR protocol to amplify DNA from six virulent strains. PCR specificity was determined by the absence of amplified products with genomic DNA from four non-virulent strains of P. brasiliensis and from eight fungal pathogens, one bacterium, two protozoa, one worm and mouse and human genomic DNA (leucocytes). The fact that the PCR product was only obtained with the genetic material from virulent isolates of P. brasiliensis suggested that this partial amplified sequence might be a marker of virulence for this fungus. The diagnostic potential of this PCR was confirmed by the successful amplification of this fragment with genomic DNA obtained in lymph node aspirate from a patient with paracoccidioidomycosis.

Conservation of hepatitis C virus nonstructural protein 3 amino acid sequence in viral isolates during liver transplantation

As a consequence of selective pressure exerted by the immune response during hepatitis C virus (HCV) infection, a high rate of nucleotide mutations in the viral genome is observed which leads to the emergence of viral escape mutants. The aim of this study was to evaluate the evolution of the amino acid (aa) sequence of the HCV nonstructural protein 3 (NS3) in viral isolates after liver transplantation. Six patients with HCV-induced liver disease undergoing liver transplantation (LT) were followed up for sequence analysis. Hepatitis C recurrence was observed in all patients after LT. The rate of synonymous (dS) nucleotide substitutions was much higher than that of nonsynonymous (dN) ones in the NS3 encoding region. The high values of the dS/dN ratios suggest no sustained adaptive evolution selection pressure and, therefore, absence of specific NS3 viral populations. Clinical genotype assignments were supported by phylogenetic analysis. Serial samples from each patient showed lower mean nucleotide genetic distance when compared with samples of the same HCV genotype and subtype. The NS3 samples studied had an N-terminal aa sequence with several differences as compared with reference ones, mainly in genotype 1b-infected patients. After LT, as compared with the sequences before, a few reverted aa substitutions and several established aa substitutions were observed at the N-terminal of NS3. Sites described to be involved in important functions of NS3, notably those of the catalytic triad and zinc binding, remained unaltered in terms of aa sequence. Rare or frequent aa substitutions occurred indiscriminately in different positions. Several cytotoxic T lymphocyte epitopes described for HCV were present in our 1b samples. Nevertheless, the deduced secondary structure of the NS3 protease showed a few alterations in samples from genotype 3a patients, but none were seen in 1b cases. Our data, obtained from patients under important selective pressure during LT, show that the NS3 protease remains well conserved, mainly in HCV 3a patients. It reinforces its potential use as an antigenic candidate for further studies aiming at the development of a protective immune response.

A Simple Technique for Large Tumor Removal During Laparoscopic Liver Resection

Experience with laparoscopic liver resections has increased in recent years, and so have the number of patients operated on by minimally invasive techniques. Specimen extraction is an important step of laparoscopic liver resection. The size of the specimen, is Usually a limitation for the use Of laparoscopy. The aim of this paper is to describe a new technique combining Pfannenstiel suprapubic incision and obstetric forceps to remove a large specimen from laparoscopic liver resections. The present technique allows an expeditious extraction of intact specimens, even huge ones, through a standard suprapubic Pfannenstiel incision. This technique has additional functional and cosmetic advantages over other techniques of specimen retrieval. We believe that the described technique is feasible, can be easily and rapidly performed, and facilitates laparoscopic liver resection by reducing the technical difficulties for specimen removal and may also be used in other abdominal laparoscopic interventions that deal with large surgical specimens.

Water excitation MPRAGE: An alternative sequence for postcontrast imaging of the abdomen in noncooperative patients at 1.5 Tesla and 3.0 Tesla MRI

Purpose: To evaluate the diagnostic image quality of post-gadolinium water excitation-magnetization-prepared rapid gradient-echo (WE-MPRAGE) sequence in abdominal examinations of noncooperative patients at 1.5 Tesla (T) and 3.0T MRI. Materials and Methods: Eighty-nine consecutive patients (48 males and 41 females; mean age +/- standard deviation, 54.6 +/- 16.6 years) who had MRI examinations including postgadolinium WE-MPRAGE were included in the study. Of 89 patients, 33 underwent noncooperative protocol at 1.5T. 10 under-went noncooperative protocol at 3.0T, and 46 underwent cooperative protocol at 3.0T. Postgadolinium WE-MPRAGE, MPRAGE, and three-dimensional gradient-echo sequences of these three different groups were qualitatively evaluated for image quality, extent of artifacts, lesion conspicuity, and homogeneity of fat-attenuation by two reviewers retrospectively, independently, and blindly. The results were compared using Wilcoxon signed rank and Mann-Whitney U tests. Kappa statistics were used to measure the extent of agreement between the reviewers. Results: The average scores indicated that the images were diagnostic for WE-MPRAGE at 1.5T and 3.0T in noncooperative patients. WE-MPRAGE achieved homogenous fat-attenuation in 31/33 (94%) of noncooperative patients at 1.5T and 10/10 (100%) of noncooperative patients at 3.0T. WE-MPRAGE at 3.0T had better results for image quality, extent of artifacts, lesion conspicuity and homogeneity of fat-attenuation compared with WE-MPRAGE at 1.5T. in noncooperative patients (P = 0.0008, 0.0006, 0.0024, and 0.0042: respectively). Kappa statistics varied between 0.76 and 1.00, representing good to excellent agreement. Conclusion: WE-MPRAGE may be used as a T1-weighted postgadolinium fat-attenuated sequence in noncooperative patients, particularly at 3.0T MRI.

Evaluation of erythrocyte dysmorphism by light microscopy with lowering of the condenser lens: A simple and efficient method

Aim: To demonstrate that the evaluation of erythrocyte dysmorphism by light microscopy with lowering of the condenser lens (LMLC) is useful to identify patients with a haematuria of glomerular or non-glomerular origin. Methods: A comparative double-blind study between phase contrast microscopy (PCM) and LMLC is reported to evaluate the efficacy of these techniques. Urine samples of 39 patients followed up for 9 months were analyzed, and classified as glomerular and non-glomerular haematuria. The different microscopic techniques were compared using receiver-operator curve (ROC) analysis and area under curve (AUC). Reproducibility was assessed by coefficient of variation (CV). Results: Specific cut-offs were set for each method according to their best rate of specificity and sensitivity as follows: 30% for phase contrast microscopy and 40% for standard LMLC, reaching in the first method the rate of 95% and 100% of sensitivity and specificity, respectively, and in the second method the rate of 90% and 100% of sensitivity and specificity, respectively. In ROC analysis, AUC for PCM was 0.99 and AUC for LMLC was 0.96. The CV was very similar in glomerular haematuria group for PCM (35%) and LMLC (35.3%). Conclusion: LMLC proved to be effective in contributing to the direction of investigation of haematuria, toward the nephrological or urological side. This method can substitute PCM when this equipment is not available.

Gastroesophageal Reflux in Severe Cases of Robin Sequence Treated With Nasopharyngeal Intubation

Objective: To study the prevalence of abnormal gastroesophageal reflux in infants with Robin sequence who had severe respiratory obstruction treated with nasopharyngeal intubation and to evaluate the efficacy of nonsurgical treatment. Design: Longitudinal prospective study. Setting: Hospital de Reabilitacao de Anomalias Craniofaciais, University of Sao Paulo, Brazil. Patients: Twenty infants with severe isolated Robin sequence treated with nasopharyngeal intubation. Interventions: We performed 24-hour esophageal pH monitoring on each child at 2, 4, and 6 months of age. Respiratory and feeding status were evaluated. We considered abnormal gastroesophageal reflux as reflux index values above the 95th percentile of the Vandenplas reference for normal children. Results: The prevalence of reflux index above the 95th percentile at the first exam was 6/20, a value significantly higher than the reference (5/103, p < .01). At the second and third exams, reflux index values were decreased. Ninety percent of the infants showed improvement of respiratory difficulty and developed oral feeding capacity. Conclusions: The prevalence of abnormal gastroesophageal reflux is higher in infants with severe cases of Robin sequence than in normal infants. Nonsurgical procedures improved respiratory and feeding difficulties of most of these infants.