Trichomes Related To An Unusual Method Of Water Retention And Protection Of The Stem Apex In An Arid Zone Perennial Species.

It is well known that trichomes protect plant organs, and several studies have investigated their role in the adaptation of plants to harsh environments. Recent studies have shown that the production of hydrophilic substances by glandular trichomes and the deposition of this secretion on young organs may facilitate water retention, thus preventing desiccation and favouring organ growth until the plant develops other protective mechanisms. Lychnophora diamantinana is a species endemic to the Brazilian 'campos rupestres' (rocky fields), a region characterized by intense solar radiation and water deficits. This study sought to investigate trichomes and the origin of the substances observed on the stem apices of L. diamantinana. Samples of stem apices, young and expanded leaves were studied using standard techniques, including light microscopy and scanning and transmission electron microscopy. Histochemical tests were used to identify the major groups of metabolites present in the trichomes and the hyaline material deposited on the apices. Non-glandular trichomes and glandular trichomes were observed. The material deposited on the stem apices was hyaline, highly hydrophilic and viscous. This hyaline material primarily consists of carbohydrates that result from the partial degradation of the cell wall of uniseriate trichomes. This degradation occurs at the same time that glandular trichomes secrete terpenoids, phenolic compounds and proteins. These results suggest that the non-glandular trichomes on the leaves of L. diamantinana help protect the young organ, particularly against desiccation, by deposition of highly hydrated substances on the apices. Furthermore, the secretion of glandular trichomes probably repels herbivore and pathogen attacks.

Bartonella Spp. Bacteremia In Blood Donors From Campinas, Brazil.

Bartonella species are blood-borne, re-emerging organisms, capable of causing prolonged infection with diverse disease manifestations, from asymptomatic bacteremia to chronic debilitating disease and death. This pathogen can survive for over a month in stored blood. However, its prevalence among blood donors is unknown, and screening of blood supplies for this pathogen is not routinely performed. We investigated Bartonella spp. prevalence in 500 blood donors from Campinas, Brazil, based on a cross-sectional design. Blood samples were inoculated into an enrichment liquid growth medium and sub-inoculated onto blood agar. Liquid culture samples and Gram-negative isolates were tested using a genus specific ITS PCR with amplicons sequenced for species identification. Bartonella henselae and Bartonella quintana antibodies were assayed by indirect immunofluorescence. B. henselae was isolated from six donors (1.2%). Sixteen donors (3.2%) were Bartonella-PCR positive after culture in liquid or on solid media, with 15 donors infected with B. henselae and one donor infected with Bartonella clarridgeiae. Antibodies against B. henselae or B. quintana were found in 16% and 32% of 500 blood donors, respectively. Serology was not associated with infection, with only three of 16 Bartonella-infected subjects seropositive for B. henselae or B. quintana. Bartonella DNA was present in the bloodstream of approximately one out of 30 donors from a major blood bank in South America. Negative serology does not rule out Bartonella spp. infection in healthy subjects. Using a combination of liquid and solid cultures, PCR, and DNA sequencing, this study documents for the first time that Bartonella spp. bacteremia occurs in asymptomatic blood donors. Our findings support further evaluation of Bartonella spp. transmission which can occur through blood transfusions.

Oropouche Virus Infection And Pathogenesis Is Restricted By Mavs, Irf-3, Irf-7, And Type I Ifn Signaling Pathways In Non-myeloid Cells.

Oropouche virus (OROV) is a member of the Orthobunyavirus genus in the Bunyaviridae family and a prominent cause of insect-transmitted viral disease in Central and South America. Despite its clinical relevance, little is known about OROV pathogenesis. To define the host defense pathways that control OROV infection and disease, we evaluated OROV pathogenesis and immune responses in primary cells and mice that were deficient in the RIG-I-like receptor signaling pathway (MDA5, RIG-I, or MAVS), downstream regulatory transcription factors (IRF-3 or IRF-7), IFN-β, or the receptor for type I IFN signaling (IFNAR). OROV replicated to higher levels in primary fibroblasts and dendritic cells lacking MAVS signaling, the transcription factors IRF-3 and IRF-7, or IFNAR. In mice, deletion of IFNAR, MAVS, or IRF-3 and IRF-7 resulted in uncontrolled OROV replication, hypercytokinemia, extensive liver damage, and death whereas wild-type (WT) congenic animals failed to develop disease. Unexpectedly, mice with a selective deletion of IFNAR on myeloid cells (CD11c Cre(+) Ifnar(f/f) or LysM Cre(+) Ifnar(f/f)) did not sustain enhanced disease with OROV or La Crosse virus, a closely related encephalitic orthobunyavirus. In bone marrow chimera studies, recipient irradiated Ifnar(-/-) mice reconstituted with WT hematopoietic cells sustained high levels of OROV replication and liver damage, whereas WT mice reconstituted with Ifnar(-/-) bone marrow were resistant to disease. Collectively, these results establish a dominant protective role for MAVS, IRF-3 and IRF-7, and IFNAR in restricting OROV virus infection and tissue injury, and suggest that IFN signaling in non-myeloid cells contributes to the host defense against orthobunyaviruses. Oropouche virus (OROV) is an emerging arthropod-transmitted orthobunyavirus that causes episodic outbreaks of a debilitating febrile illness in humans in countries of South and Central America. The continued expansion of the range and number of its arthropod vectors increases the likelihood that OROV will spread into new regions. At present, the pathogenesis of OROV in humans or other vertebrate animals remains poorly understood. To define cellular mechanisms of control of OROV infection, we performed infection studies in a series of primary cells and mice that were deficient in key innate immune genes involved in pathogen recognition and control. Our results establish that a MAVS-dependent type I IFN signaling pathway has a dominant role in restricting OROV infection and pathogenesis in vivo.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Influência da luminosidade e da camada de cera epicuticular de superfícies de folhas de soja na infecção de Phakopsora pachyrhizi

A ferrugem asiática, causada pelo fungo Phakopsora pachyrhizi, apresenta-se como um dos mais graves problemas fitossanitários da cultura da soja no Brasil, principalmente por não existirem, até o presente momento, cultivares com níveis de resistência satisfatórios. Objetivou-se estudar a influência da luminosidade e da camada de cera das superfícies foliares na infecção de folhas de soja por P. pachyrhizi. A superfície adaxial ou abaxial de folíolos do primeiro trifólio de plantas da cultivar BRS 154, estádio fenológico V2, foi inoculada com suspensão de 10(5) urediniósporos/mL-1. As plantas foram mantidas por 24 horas em câmara úmida e temperatura de 23ºC, sob luz ou escuro, em delineamento fatorial. Posteriormente, permaneceram 14 dias em fotoperíodo de 12 horas, sendo em seguida avaliada a densidade de lesões e a severidade da doença. Em um segundo experimento, avaliou-se in vitro , no escuro e na luz, a porcentagem de germinação de urediniósporos e de formação de apressórios. As camadas de cera adaxial e abaxial dos folíolos foram analisadas quantitativamente (extrações com clorofórmio) e estruturalmente (microscopia eletrônica de varredura). A densidade de lesões e a severidade foram maiores quando se inoculou a superfície adaxial de plantas incubadas no escuro, sem interação significativa entre os fatores. A germinação dos esporos no escuro (40,7%) foi significativamente superior à germinação na luz (28,5%). O mesmo ocorreu para a formação de apressórios, no escuro (24,7%) e na luz (12,8%). A quantidade e a estrutura das ceras epicuticulares não apresentaram diferenças entre as duas superfícies.

Experimental infections with Paracoccidioides brasiliensis obtained from armadillos: comparison to clinical isolates

Paracoccidioides brasiliensis causes paracoccidioidomycosis (PCM) that is one of the most prevalent systemic human mycoses in Latin America. Armadillos show a high incidence of PCM infection and could, therefore, be a natural reservoir for this fungus. In this study were compared the virulence profiles of isolates obtained from nine-banded armadillos (Dasypus novemcinctus) (PbT1 and PbT4) and isolates from PCM patients (Pb265 and Bt83). Pathogenicity was evaluated by fungal load and analysis of colony morphology. Immunity against the fungus was tested by delayed type hypersensitivity test (DTH) and antibody quantification by ELISA. The higher virulence of PbT1 and PbT4 was suggested by higher fungal load in spleen and lungs. Armadillo isolates and Bt83 presented a cotton-like surface contrasting with the cerebriform appearance of Pb265. All isolates induced cellular and humoral immune responses in infected BALB/c mice. DTH reactions were similarly induced by the four isolates, however, a great variability was observed in specific antibody levels, being the highest ones induced by Bt83 and PbT4. The present work confirms that armadillos harbor P. brasiliensis, whose multiplication and induced immunity in experimentally infected mice are heterogeneous, resembling the behavior of isolates from human PCM. This study reinforces the possibility that armadillos play an important role in the biological cycle of this pathogen.

Novos registros e potencial epidemiológico de algumas espécies de mosquitos (Diptera, Culicidae), no Estado do Rio Grande do Sul

INTRODUÇÃO: A vigilância entomológica tem se mostrado uma importante estratégia de monitoramento da fauna de culicídeos com vistas a predizer o risco de exposição a espécies vetoras de patógenos. Esse trabalho apresenta uma lista de mosquitos identificados pela primeira vez no Rio Grande do Sul e discute o potencial epidemiológico de algumas espécies ocorrentes no Município de Maquiné com registros em outras regiões do Estado. MÉTODOS: Os mosquitos foram coletados com aspirador de Nasci e armadilhas CDC, entre dezembro de 2006 e dezembro de 2008, em área silvestre, rural e urbana do Município de Maquiné. RESULTADOS: Foram verificadas 55 espécies, das quais 22 são registradas pela primeira vez no estado e 10 são potencialmente vetoras do vírus Saint Louis, Oropouche, Aura, Trocara, Ilhéus, Rocio, Una, West Nile e encefalite equina do leste. CONCLUSÕES: Esses dados demonstram a importância da Vigilância Entomológica como ferramenta de informação e ação para a Vigilância em Saúde.

Aeromonas presence in drinking water from collective reservoirs and wells in peri-urban area in Brazil

Aeromonas genus is considered an emerging pathogen and its presence in drinking water supplies is a reason to public health concern. This study investigated the occurrence of Aeromonas in samples from collective reservoirs and wells used as drinking water sources in a peri-urban area. A total of 35 water samples were collected from collective reservoirs and 32 from wells bimonthly, from September 2007 to September 2008. Aeromonas spp determination was carried out using a Multiple-Tube Technique. Samples were inoculated into alkaline peptone water and the superficial film formed was transferred to blood agar plates amended with ampicillin. Typical Aeromonas colonies were submitted to a biochemical screening and then to biochemical tests for species differentiation. Aeromonas was detected in 13 (19%) of the 69 samples examined (6 from collective reservoirs and 7 from wells). Concentrations of Aeromonas in collective reservoirs ranged from <0.3 to 1.2 x10²MPN/100mL and, in wells, from <0.3 to 2.4 x10²MPN/100mL. The most frequent specie in the collective reservoir samples was Aeromonas spp (68%), followed by A. encheleia (14%) and A. allosaccharophila (8%) and A. hydrophila (8%). Aeromonas spp (87%) was the most frequent specie isolated from well samples, followed by A. allosacchariphila (8%), A. encheleia (2%) and A. jandaei (5%). These data show the presence and diversity of Aeromonas genus in the samples analyzed and highlight that its presence in drinking water poses a significant public health concern.

Evaluation of a recombinant p24 antigen for the detection of Feline Immunodeficiency Virus-specific antibodies

Feline Immunodeficiency Virus is a worldwide infection and is considered a significant pathogen. The diagnosis of FIV infections is mainly based on commercially available rapid tests that are highly expensive in Brazil, hence it is rarely performed in the country. Furthermore, lentiviruses grow slowly and poorly in tissue cultures, making the production of viral antigen by classic means and thus the establishment of FIV immunodiagnosis impracticable. In order to deal with this, recombinant DNA techniques were adopted to produce the protein p24, a viral capsid antigen. The protein's reactivity evaluation analyzed by Western blot indicated that this recombinant antigen can be a useful tool for the immunodiagnostic of FIV infections.

Seroprevalence of Rickettsia bellii and Rickettsia felis in dogs, São José dos Pinhais, State of Paraná, Brazil

Brazilian spotted fever (BSF) is a vector-borne zoonosis caused by Rickettsia rickettsii bacteria. Dogs can be host sentinels for this bacterium. The aim of the study was to determine the presence of antibodies against Rickettsia spp. in dogs from the city of São José dos Pinhais, State of Paraná, Southern Brazil, where a human case of BSF was first reported in the state. Between February 2006 and July 2007, serum samples from 364 dogs were collected and tested at 1:64 dilutions by indirect immunofluorescence assay (IFA) against R. rickettsii and R. parkeri. All sera that reacted at least to one of Rickettsia species were tested against the six main Rickettsia species identified in Brazil: R. rickettsii, R. parkeri, R. bellii, R. rhipicephali, R. amblyommii and R. felis. Sixteen samples (4.4%) reacted to at least one Rickettsia species. Among positive animals, two dogs (15.5%) showed suggestive titers for R. bellii exposure. One sample had a homologous reaction to R. felis, a confirmed human pathogen. Although Rickettsia spp. circulation in dogs in the area studied may be considered at low prevalence, suggesting low risk of human infection, the present data demonstrate for the first time the exposure of dogs to R. bellii and R. felis in Southern Brazil.

Heartworm (Dirofilaria immitis) disease in a Brazilian oncilla (Leopardus tigrinus)

Heartworm disease is caused by the intravascular nematode Dirofilaria immitis, a pathogen of public health importance usually associated to domestic dogs and cats, and to a lesser extend to other mammal species. The oncilla (Leopardus tigrinus) is a threatened neotropic felid species that naturally occurs in Brazil. Here, we report the encounter of adult and larval stages of heartworms in a female specimen of L. tigrinus, probable of free-ranging origin, from Ubatuba, São Paulo, Brazil, which died showing clinical signals compatible with heartworm disease. This was the first reported case of D. immitis infection and associated disease in L. tigrinus, also suggesting that the oncilla acted as a definitive host for this parasite. The present findings confirmed D. immitis as a pathogenic agent for this felid species, thus supporting the recommendation for the inclusion of diagnostic testing for this pathogen in routine health screening procedures for captive and free-ranging oncillas in Brazil, especially in those localities where climate conditions support the occurrence of the parasite. Potential reservoirs as oncillas are established beyond the reach of veterinary care, thus representing a continuing risk for domestic animals and humans acquiring heartworm infection. We encourage further serologic and molecular studies aiming to establish D. immitis prevalences in L. tigrinus and other wild carnivores in the region of Ubatuba, as well as ecological and veterinary studies to access the role of this pathogen for the survival of this threatened felid species.

Aeromonas detection and their toxins from drinking water form reservoirs and drinking fountains

Aeromonads are inhabitants of aquatic ecosystems and are described as being involved in intestinal disturbances and other infections. A total of 200 drinking water samples from domestic and public reservoirs and drinking fountains located in São Paulo (Brazil), were analyzed for the presence of Aeromonas. Samples were concentrated by membrane filtration and enriched in APW. ADA medium was used for Aeromonas isolation and colonies were confirmed by biochemical characterization. Strains isolated were tested for hemolysin and toxin production. Aeromonas was detected in 12 samples (6.0%). Aeromonas strains (96) were isolated and identified as: A. caviae (41.7%), A. hydrophila (15.7%), A.allosacharophila (10.4%), A. schubertii (1.0%) and Aeromonas spp. (31.2%).The results revealed that 70% of A. caviae, 66.7% of A. hydrophila, 80% of A. allosacharophila and 46.6% of Aeromonas spp. were hemolytic. The assay for checking production of toxins showed that 17.5% of A. caviae, 73.3% of A. hydrophila, 60% of A. allosacharophila, 100% of A. schubertii, and 33.3% of Aeromonas spp. were able to produce toxins. The results demonstrated the pathogenic potential of Aeromonas, indicating that the presence of this emerging pathogen in water systems is a public health concern

Toll-like receptor 4 (TLR4) expression in human and murine pancreatic beta-cells affects cell viability and insulin homeostasis

Background: Toll-like receptor 4 (TLR4) is widely recognized as an essential element in the triggering of innate immunity, binding pathogen-associated molecules such as Lipopolysaccharide (LPS), and in initiating a cascade of pro-inflammatory events. Evidence for TLR4 expression in non-immune cells, including pancreatic beta-cells, has been shown, but, the functional role of TLR4 in the physiology of human pancreatic beta-cells is still to be clearly established. We investigated whether TLR4 is present in beta-cells purified from freshly isolated human islets and confirmed the results using MIN6 mouse insulinoma cells, by analyzing the effects of TLR4 expression on cell viability and insulin homeostasis. Results: CD11b positive macrophages were practically absent from isolated human islets obtained from nondiabetic brain-dead donors, and TLR4 mRNA and cell surface expression were restricted to beta-cells. A significant loss of cell viability was observed in these beta-cells indicating a possible relationship with TLR4 expression. Monitoring gene expression in beta-cells exposed for 48h to the prototypical TLR4 ligand LPS showed a concentration-dependent increase in TLR4 and CD14 transcripts and decreased insulin content and secretion. TLR4-positive MIN6 cells were also LPS-responsive, increasing TLR4 and CD14 mRNA levels and decreasing cell viability and insulin content. Conclusions: Taken together, our data indicate a novel function for TLR4 as a molecule capable of altering homeostasis of pancreatic beta-cells.

Detection of the bacterium, Xylella fastidiosa, in saliva of glassy-winged sharpshooter, Homalodisca vitripennis

Homalodisca vitripennis ( Germar) ( Hemiptera: Cicadellidae), the glassy- winged sharpshooter, is one of the most important vectors of the bacterium, Xylella fastidiosa subsp. piercei ( Xanthomonadales: Xanthomonadaceae) that causes Pierce's Disease in grapevines in California. In the present study we report a new method for studying pathogen transmission or probing behavior of H. vitripennis. When confined, H. vitripennis attempt to probe the surface of sterile containers 48 hours post- acquisition of X. f. piercei. The saliva deposited during attempted feeding probes was found to contain X. f. piercei. We observed no correlation between X. f. piercei titers in the foregut of H. vitripennis that fed on Xylella- infected grapevines and the presence of this bacterium in the deposited saliva. The infection rate after a 48 h post- acquisition feeding on healthy citrus and grapevines was observed to be 77% for H. vitripennis that fed on grapevines and 81% for H. vitripennis that fed on citrus, with no difference in the number of positive probing sites from H. vitripennis that fed on either grapevine or citrus. This method is amenable for individual assessment of X. f. piercei- infectivity, with samples less likely to be affected by tissue contamination that is usually present in whole body extracts.

Origins of the Xylella fastidiosa Prophage-Like Regions and Their Impact in Genome Differentiation

Xylella fastidiosa is a Gram negative plant pathogen causing many economically important diseases, and analyses of completely sequenced X. fastidiosa genome strains allowed the identification of many prophage-like elements and possibly phage remnants, accounting for up to 15% of the genome composition. To better evaluate the recent evolution of the X. fastidiosa chromosome backbone among distinct pathovars, the number and location of prophage-like regions on two finished genomes (9a5c and Temecula1), and in two candidate molecules (Ann1 and Dixon) were assessed. Based on comparative best bidirectional hit analyses, the majority (51%) of the predicted genes in the X. fastidiosa prophage-like regions are related to structural phage genes belonging to the Siphoviridae family. Electron micrograph reveals the existence of putative viral particles with similar morphology to lambda phages in the bacterial cell in planta. Moreover, analysis of microarray data indicates that 9a5c strain cultivated under stress conditions presents enhanced expression of phage anti-repressor genes, suggesting switches from lysogenic to lytic cycle of phages under stress-induced situations. Furthermore, virulence-associated proteins and toxins are found within these prophage-like elements, thus suggesting an important role in host adaptation. Finally, clustering analyses of phage integrase genes based on multiple alignment patterns reveal they group in five lineages, all possessing a tyrosine recombinase catalytic domain, and phylogenetically close to other integrases found in phages that are genetic mosaics and able to perform generalized and specialized transduction. Integration sites and tRNA association is also evidenced. In summary, we present comparative and experimental evidence supporting the association and contribution of phage activity on the differentiation of Xylella genomes.