994 resultados para Independent Sequence
Resumo:
The H1',H2' and H2″ regions of the 270-MHz PMR spectra of two deoxydinucleotides, d-pTpA and d-pApT, have been analyzed. The coupling constants in the sugar ring indicate that both A and T sugars have a tendency to acquire 2E conformations. There is also a marginal difference in the 2E populations of the T sugar in the two dinucleotides. The trends in the chemical shifts of base protons indicate different stacking of the bases in d-pApT and d-pTpA. The sequence effects on base stacking and pentose conformation are discussed.
Resumo:
While many placental herpesvirus genomes have been fully sequenced, the complete genome of a marsupial herpesvirus has not been described. Here we present the first genome sequence of a metatherian herpesvirus, Macropodid herpesvirus 1 (MaHV-1).
Resumo:
Based upon a stereochemical guideline, two topologically distinct types of helicalduplexes have been deduced for a polynucleotide duplex with alternating purine pyrimidine sequence (PAPP): (a) right-handed uniform (RU) helix and (b) left-handed zig-zag (LZ) helix. Both structures have trinucleoside diphosphate as the basic unit wherein the purine pyrimidine fragment has a different conformation from the pyrimidine-purine fragment. Thus, RU and LZ helices represent two different classes of sequence-dependent molecular conformations for PAPP. The conformationalf eatures of an RU helix of PAPP in B-form and three LZ-helices for B-, D- and Z-forms are discussed.
Resumo:
In an earlier communication[l] we have indicated a general graphical design procedure for a sequence of sparger reactors in which a second order liquid phase reaction proceeds in a stagewise fashion. The prediction of the reactant concentration in each stage and hence the conversion depended on a search procedure initiated along a straight line representing the mass balance equation at the given stage and drawn from the known feed stage located on the abscissa in a E-IU diagram for the given system.
Resumo:
GERMINATION transfers a metabolically inert embryo into an active state of growth and development. The presence of conserved mRNAs has been demonstrated in different species of eggs and seeds1–4. In rice embryos, germination was shown to be independent of the synthesis of RNA up to 18–24 h after the start of imbibition5, although RNA synthesis was detected as early as 9 h after the start of imbibition. In this report, the sequence of the transcriptional events taking place during the early phase of the germination of rice embryos are presented.
Resumo:
A methodology for determining spacecraft attitude and autonomously calibrating star camera, both independent of each other, is presented in this paper. Unlike most of the attitude determination algorithms where attitude of the satellite depend on the camera calibrating parameters (like principal point offset, focal length etc.), the proposed method has the advantage of computing spacecraft attitude independently of camera calibrating parameters except lens distortion. In the proposed method both attitude estimation and star camera calibration is done together independent of each other by directly utilizing the star coordinate in image plane and corresponding star vector in inertial coordinate frame. Satellite attitude, camera principal point offset, focal length (in pixel), lens distortion coefficient are found by a simple two step method. In the first step, all parameters (except lens distortion) are estimated using a closed-form solution based on a distortion free camera model. In the second step lens distortion coefficient is estimated by linear least squares method using the solution of the first step to be used in the camera model that incorporates distortion. These steps are applied in an iterative manner to refine the estimated parameters. The whole procedure is faster enough for onboard implementation.
Resumo:
The effect of phenobarbital on the rates of the synthesis of the protein and heme moieties of cytochrome P-450 has been studied. For this purpose, cytochrome P-450 has been partially purified as its P-420 derivative and the labeled amino acid incorporation into the protein has been studied after subjecting a partially purified preparation to sodium dodecyl sulfate gel electrophoresis. The incorporation studies into the protein species after sodium dodecyl sulfate gel electrophoresis reveal that the drug primarily accelerates the rate of apoprotein synthesis followed by an increase in the rate of heme synthesis. The messenger for apocytochrome P-450 appears to be fairly stable.
Resumo:
From the autocorrelation function of geomagnetic polarity intervals, it is shown that the field reversal intervals are not independent but form a process akin to the Markov process, where the random input to the model is itself a moving average process. The input to the moving average model is, however, an independent Gaussian random sequence. All the parameters in this model of the geomagnetic field reversal have been estimated. In physical terms this model implies that the mechanism of reversal possesses a memory.
Resumo:
The sequence distribution studies on the acrylonitrile-methylmethacrylate copolymer of high methylmethacrylate (M) content (30%
Resumo:
Antibodies were raised in rabbits against the bovine serum albumin conjugate of dpApT. Analysis by double diffusion in agar gel and quantitative precipitation test showed the presence of antibodies specific to the hapten in the antisera. Quantitative data on the specificity of the antibodies were obtained by studying the inhibition of the binding of 3H-dpApT to the anti-sera by various nonradioactive mono- and oligonucleotides, using a nitrocellulose membrane binding assay. The antibodies were found to be highly specific for the dinucleotide sequence dpApT. The antibodies were able to bind to synthetic oligonucleotides containing the sequence dpApT and to denatured calf thymus DNA.
Resumo:
Reaction of the bromoketals 3, 7a-g and 11 with tri-n-butyltin chloride and sodium cyanoborohydride in the presence of a catalytic amount of AIBN furnished the ethers 5, 8a-g and 13 via a tandem sequence comprising of a radical cyclisation reaction and tri-n-butylhalostannane and sodium cyanoborohydride mediated reductive demethoxylation of the resulting cyclic ketals.
Resumo:
Genetic studies on phylogeography and adaptive divergence in Northern Hemisphere fish species such as three-spined stickleback (Gasterosteus aculeatus) provide an excellent opportunity to investigate genetic mechanisms underlying population differentiation. According to the theory, the process of population differentiation results from a complex interplay between random and deterministic processes as well historical factors. The main scope in this thesis was to study how historical factors like the Pleistocene ice ages have shaped the patterns molecular diversity in three-spined stickleback populations in Europe and how this information could be utilized in the conservation genetic context. Furthermore, identifying footprints of natural selection at the DNA level might be used in identifying genes involved in evolutionary change. Overall, the results from phylogeographic studies indicate that the three-spined stickleback has colonized the Atlantic basin relatively recently but constitutes three major evolutionary lineages in Europe. In addition, the colonization of freshwater appears to result from multiple and independent invasions by the marine conspecifics. Molecular data together with morphology suggest that the most divergent freshwater populations are located in the Balkan Peninsula and these populations deserve a special conservation genetic status without warranting further taxonomical classification. In order to investigate the adaptive divergence in Fennoscandian three-spined stickleback populations several approaches were used. First, sequence variability in the Eda-gene, coding for the number of lateral plates, was concordant with the previously observed global pattern. Full plated allele is in high frequencies among marine populations whereas low plated allele dominates in the freshwater populations. Second, a microsatellite based genome scan identified both indications of balancing and directional selection in the three-spined stickleback genome, i.e. loci with unusually similar or unusually different allele frequencies over populations. The directionally selected loci were mainly associated with the adaptation to freshwater. A follow up study conducting a more detailed analysis in a chromosome region containing a putatively selected gene locus identified a fairly large genomic region affected by natural selection. However, this region contained several gene predictions, all of which might be the actual target of natural selection. All in all, the phylogeographic and adaptive divergence studies indicate that most of the genetic divergence has occurred in the freshwater populations whereas the marine populations have remained relatively uniform.
Resumo:
The 3prime terminal 1255nt sequence of Physalis mottle virus (PhMV) genomic RNA has been determined from a set of overlapping cDNA clones. The open reading frame (ORF) at the 3prime terminus corresponds to the amino acid sequence of the coat protein (CP) determined earlier except for the absence of the dipeptide, Lys-Leu, at position 110-111. In addition, the sequence upstream of the CP gene contains the message coding for 178 amino acid residues of the C-terminus of the putative replicase protein (RP). The sequence downstream of the CP gene contains an untranslated region whose terminal 80 nucleotides can be folded into a characteristic tRNA-like structure. A phylogenetic tree constructed after aligning separately the sequence of the CP, the replicase protein (RP) and the tRNA-like structure determined in this study with the corresponding sequences of other tymoviruses shows that PhMV wrongly named belladonna mottle virus [BDMV(I)] is a separate tymovirus and not another strain of BDMV(E) as originally envisaged. The phylogenetic tree in all the three cases is identical showing that any subset of genomic sequence of sufficient length can be used for establishing evolutionary relationships among tymoviruses.
Resumo:
The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.