997 resultados para Hospedeiro alternativo


Relevância:

20.00% 20.00%

Publicador:

Resumo:

A importância da utilização de sinergistas está relacionada à minimização da quantidade de inseticida químico necessária para o controle de insetos, podendo contribuir com a diminuição da contaminação ambiental e com a preservação de insetos benéficos. O objetivo deste trabalho foi avaliar a sinergia e a homogeneidade de resposta de lagartas de Spodoptera frugiperda (J. E. Smith, 1797) a subdose do óleo essencial de Piper aduncum L. (OPA) em combinações com formulações de piretróides comparadas ao butóxido de piperonila (PBO). Foram obtidos fatores de sinergismo (FS) para comparação dos tratamentos entre si. Por contato residual, evidenciou-se significativa potencialização dos inseticidas formulados com lambda-Cialotrina (FS= 87,7), Deltametrina (FS= 1,7 -35,9) e beta-Ciflutrina (FS= 45,0 -58,0). Já por contato tópico, ocorreu significativa potencialização dos inseticidas lambda-Cialotrina (FS= 5,7 ? 5,8), Deltametrina (FS= 6,0) e beta-Ciflutrina (FS= 5,3) quando em combinação com o óleo essencial. Com exceção de lambda-Cialotrina ½ e ¼ PA contato tópico e de beta-Ciflutrina ½ e ¼ OPA contato residual, as demais combinações sinérgicas apresentaram homogeneidade de resposta tanto por contato tópico como residual para pelo menos uma das combinações sinérgicas com o OPA. As combinações do OPA com os piretróides avaliados podem indicar ser este óleo essencial uma opção ao PBO.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In questo elaborato è presentato uno studio che riguarda lo sviluppo di nuovi materiali compositi fibro-rinforzati a matrice uretano-acrilato termoindurente. Lo studio è basato sulla ricerca di un diluente reattivo alternativo a stirene e vinil toluene, attualmente utilizzati in industria, in grado di migliorare l’aspetto di sicurezza e pericolosità legato alla manipolazione e all’utilizzo dei diluenti, mantenendo o migliorando le proprietà finali della resina. I diluenti selezionati sono circa 30, in base a indicazioni di pericolo EH&S, proprietà chimico fisiche, funzionalità e odore. Sono stati caratterizzati sia i diluenti reattivi puri che i rispettivi formulati uretano acrilato formati da resina addizionata di diluente reattivo. Le proprietà studiate sono state: reattività e comportamento reologico (viscosità e gel time), temperatura di transizione vetrosa (Tg), assorbimento d’acqua, ritiro volumetrico e proprietà meccaniche di resistenza a flessione (3-point bending) e impatto (Charpy). Sulla base dei risultati di screening, sono stati selezionati i diluenti reattivi più performanti e sono stati utilizzati per creare materiali compositi a matrice uretan acrilato rinforzati con fibra di vetro unidirezionale, ottenuti con tecnica di infusione sotto vuoto. Infine sono state caratterizzate le proprietà dei materiali compositi per valutarne la resistenza a flessione, a trazione, all’impatto, l’interlaminar shear strenght (ILSS) e l’assorbimento d’acqua.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In questi ultimi anni la Pandemia di ha sconvolto in pochissime settimane il mondo che tutti eravamo soliti vivere. Se prendiamo in esame il caso della famosa “Gen Z”, tutti gli individui nati tra gli anni 1997 e 2012, riusciamo a stilare una serie di possibili cause, dovute all’impatto del Covid, che hanno avuto un ruolo fondamentale all’interno del contesto legati alla sfera mentale. In primis, la realtà quotidiana delle Scuole di tutta Europa è stata influenzata, basti pensare alla chiusura delle scuole, all’utilizzo della didattica a distanza e all’impreparazione di fronte a questa situazione da parte di insegnanti e di studenti. In secondo luogo l’utilizzo della tecnologia ha subìto nei giovani un incremento esponenziale, basta sapere che nell’anno della pandemia il tempo che i ragazzi hanno passato online è raddoppiato. A tutto ciò che è stato descritto occorre aggiungere la questione che riguarda il tabù sull’argomento della salute mentale e come esso viene affrontato dalle Istituzioni Scolastiche. L’approccio da parte dei giovani con questo argomento è difficoltoso: pregiudizi, impreparazione e un’errata comunicazione ne fanno da padroni. Da ciò si è voluta definire la domanda che ha guidato le attività del mio progetto: “Come posso permettere agli studenti delle Scuole superiori che entrano in contatto per la prima volta con le tematiche legate alla salute mentale di creare un approccio informale, libero e spontaneo e al tempo stesso di ottimizzare la comunicazione relativa all’ingaggio di tali argomenti?” L’elaborato del progetto propone da un lato, attraverso il sostegno degli enti che organizzano incontri extra-scolastici sulla salute mentale, un metodo di approccio alternativo e più attuale legato al contesto giovanile dall’altro, mediante l’ideazione di un’applicazione smartphone, si vuole proporre agli studenti uno strumento che sia di supporto all’introduzione del tema sfruttando canali innovativi di educazione, di divertimento e di condivisione.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

O Centro de Saúde Cabana, localizado na região oeste de Belo Horizonte, apresenta índice alto risco de vulneralidade, associado a uma baixa condição socioeconômica, cultural e de segurança pública. Este Centro de saúde tem seis equipes de saúde da família que atendem aproximadamente 33 mil pessoas. Dentre os problemas detectados entre essas pessoas, destaca-se o alto número de mulheres de meia idade depressivas. A depressão na mulher apresenta causas multifatoriais de difícil identificação, sendo que, na maioria dos casos a medicação é a alternativa mais recomendada, associada à mudança do estilo e hábitos de vida. O presente estudo baseado na pesquisa bibliográfica narrativa , com levantamento de material no SciELO, em livros e documentos do Ministério da Saúde objetivou elaborar um plano de ação com alternativas saudáveis e eficazes no controle da depressão de mulheres de meia idade. O projeto "Bem Viver" pretende oferecer exercícios físicos como tratamento alternativo e prevenção da depressão em mulheres de meia idade inseridas no Sistema Único de Saúde -SUS da Região Oeste de Belo Horizonte.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

hematopoietic stem cell transplantation (HSCT) is associated with more respiratory infections due to immunosuppression. this study aimed to verify the frequency of rhinosinusitis after HSCT, and the association between rhinosinusitis and chronic graft vs. host disease (GVHD) and type of transplantation, clinical treatment, surgical treatment, and survival. this was a retrospective study in a tertiary university hospital. A total of 95 patients with hematological diseases undergoing HSCT between 1996 and 2011 were selected. chronic myeloid leukemia was the most prevalent disease. The type of transplant most often performed was the allogenic type (85.26%). The frequency of rhinosinusitis was 36%, with no difference between the autologous and the allogenic types. Chronic GVHD occurred in 30% of patients. Patients with GVHD had a higher frequency and recurrence of rhinosinusitis, in addition to more frequent need for endoscopic sinusectomy and decreased overall survival. there was a higher frequency of rhinosinusitis in HSCT and GVHD. The type of transplant does not appear to predispose to the occurrence of rhinosinusitis. GVHD seems to be an aggravating factor and requires a more stringent treatment.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

An alternative proposal for floor heating system by means of electric resistance for both chick and piggy installation is presented in this work. Several formulations of rice husk and cement mortar boards were used. An electronic device controlled all board temperature. This system presented a good efficiency design. The conventional cement mortar mixed with rice husk showed a better performance.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The main objective of this work is the study of the effect of rice husk addition on the physical and mechanical properties of soil-cement, in order to obtain an alternative construction material. The rice husk preparation consisted of grinding, sieving, and the pre-treatment with lime solution. The physical characteristics of the soil and of the rice husk were determined. Different amounts of soil, cement and rice husk were tested by compaction and unconfined compression. The specimens molded according to the treatments applied to the mixtures were subsequently submitted to compression testing and to tensile splitting cylinder testing at 7 and 28 days of age and to water absorption testing. After determining its physical and mechanical characteristics, the best results were obtained for the soil + 12% (cement + rice husk) mixture. The results showed a promising use as an alternative construction material.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The use of technology to protect and produce vegetables and ornamental plants was developed over several adaptation phases that supported the demand for quality and amount of products. These developments also reduced production costs and climate damage to the crops. Many of these adaptations were carried out by farmers on their own initiative, using different materials and devices to solve their problems. This study was carried out at Agricultural Engineering College - Campinas University/UNICAMP, from December 2002 to January 2003, with the objective of evaluating the deformations of the constructive system of bamboo structure for greenhouses, submitted to different spacing among columns, and different vertical strains. It was tested the use of beams and columns built with bamboo stems from the specie Bambusa tuldoides Munro. The beams and columns were tied together with plastic spacing parts, specially designed to facilitate and standardize the construction of the building, providing more resistance and stability. Three column spaces (2.0, 2.5 and 3.0 m) were evaluated under different load strains. The best result was obtained with a spacing of 2.5 m.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The research approaches recycling of urban waste compost (UWC) as an alternative fertilizer for sugarcane crop and as a social and environmental solution to the solids residuals growth in urban centers. A mathematical model was used in order to know the metal dynamics as decision support tool, aiming to establish of criteria and procedures for UWC's safe use, limited by the amount of heavy metal. A compartmental model was developed from experimental data in controlled conditions and partially checked with field data. This model described the heavy metal transference in the system soil-root-aerial portion of sugarcane plants and concluded that nickel was metal to be concern, since it takes approximately three years to be attenuated in the soil, reaching the aerial portions of the plant at high concentrations. Regarding factors such as clay content, oxide level and soil pH, it was observed that for soil with higher buffering capacity, the transfer of the majority of the metals was slower. This model may become an important tool for the attainment of laws regarding the UWC use, aiming to reduce environment contamination the waste accumulation and production costs.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The present study evaluated the progression of osteogenic cell cultures exposed to a novel calcium aluminate cement (CAC+) in comparison with the gold standard mineral trioxide aggregate (MTA). Cells were enzimatically isolated from newborn rat calvarial bone, plated on glass coverslips containing either CAC+ or a control MTA samples in the center, and grown under standard osteogenic conditions. Over the 10-day culture period, roundening of sample edges was clearly noticed only for MTA group. Although both cements supported osteogenic cell adhesion, spreading, and proliferation, CAC+-exposed cultures showed significantly higher values in terms of total cell number at days 3 and 7, and total protein content and alkaline phosphatase activity at day 10. The present in vitro results indicate that the exposure to CAC+ supports a higher differentiation of osteogenic cells compared with the ones exposed to MTA. Further experimental studies should consider CAC+ as a potential alternative to MTA when the repair of mineralized tissues is one of the desired outcomes in endodontic therapy.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Os cuidados gerais relativos ao paciente submetido ao transplante de medula óssea (TMO) incluem avaliações odontológicas rotineiras, as quais devem estar inseridas em um contexto multiprofissional. A cavidade oral constitui um sítio propício a infecções com grande potencial de desenvolvimento de bacteremia, sendo que lesões infecciosas devem ser previamente tratadas e controladas pelo cirurgião-dentista. O objetivo desta revisão é discutir questões em destaque na literatura nacional e internacional referentes aos quadros inflamatórios e infecciosos orais de importância para o paciente transplantado de medula óssea, tanto os predisponentes a complicações durante o transplante, quanto os que ocorrem durante e após a terapia mielossupressora. Destaca-se na literatura a doença periodontal avançada, a qual constitui um quadro infeccioso crônico que deve ser evitado ou controlado durante o TMO, principalmente devido à presença de S. viridans. Os fatores de risco para mucosite oral (OM), doença do enxerto contra o hospedeiro (DECH) e xerostomia ainda não estão definidos, principalmente para OM e DECH. São citadas na literatura alternativas promissoras de tratamento para OM, tais como crioterapia, administração de fatores de crescimento e laserterapia. O risco aumentado de cárie é controverso e, dentre as lesões fúngicas e virais, destacam-se as infecções orais e de orofaringe por Candida e pela família de herpesvírus, de importância clínica considerável. Em pacientes pediátricos são relevantes as alterações craniofaciais e dentárias, decorrentes principalmente da radioterapia.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Visceral leishmaniasis (VL) is a widely spread zoonotic disease. In Brazil the disease is caused by Leishmania (Leishmania) infantum chagasi. Peridomestic sandflies acquire the etiological agent by feeding on blood of infected reservoir animals, such as dogs or wildlife. The disease is endemic in Brazil and epidemic foci have been reported in densely populated cities all over the country. Many clinical features of Leishmania infection are related to the host-parasite relationship, and many candidate virulence factors in parasites that cause VL have been studied such as A2 genes. The A2 gene was first isolated in 1994 and then in 2005 three new alleles were described in Leishmania (Leishmania) infantum. In the present study we amplified by polymerase chain reaction (PCR) and sequenced the A2 gene from the genome of a clonal population of L. (L.) infantum chagasi VL parasites. The L. (L.) infantum chagasi A2 gene was amplified, cloned, and sequenced in. The amplified fragment showed approximately 90% similarity with another A2 allele amplified in Leishmania (Leishmania) donovani and in L.(L.) infantum described in literature. However, nucleotide translation shows differences in protein amino acid sequence, which may be essential to determine the variability of A2 genes in the species of the L. (L.) donovani complex and represents an additional tool to help understanding the role this gene family may have in establishing virulence and immunity in visceral leishmaniasis. This knowledge is important for the development of more accurate diagnostic tests and effective tools for disease control.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A ferrugem asiática, causada pelo fungo Phakopsora pachyrhizi, apresenta-se como um dos mais graves problemas fitossanitários da cultura da soja no Brasil, principalmente por não existirem, até o presente momento, cultivares com níveis de resistência satisfatórios. Objetivou-se estudar a influência da luminosidade e da camada de cera das superfícies foliares na infecção de folhas de soja por P. pachyrhizi. A superfície adaxial ou abaxial de folíolos do primeiro trifólio de plantas da cultivar BRS 154, estádio fenológico V2, foi inoculada com suspensão de 10(5) urediniósporos/mL-1. As plantas foram mantidas por 24 horas em câmara úmida e temperatura de 23ºC, sob luz ou escuro, em delineamento fatorial. Posteriormente, permaneceram 14 dias em fotoperíodo de 12 horas, sendo em seguida avaliada a densidade de lesões e a severidade da doença. Em um segundo experimento, avaliou-se in vitro , no escuro e na luz, a porcentagem de germinação de urediniósporos e de formação de apressórios. As camadas de cera adaxial e abaxial dos folíolos foram analisadas quantitativamente (extrações com clorofórmio) e estruturalmente (microscopia eletrônica de varredura). A densidade de lesões e a severidade foram maiores quando se inoculou a superfície adaxial de plantas incubadas no escuro, sem interação significativa entre os fatores. A germinação dos esporos no escuro (40,7%) foi significativamente superior à germinação na luz (28,5%). O mesmo ocorreu para a formação de apressórios, no escuro (24,7%) e na luz (12,8%). A quantidade e a estrutura das ceras epicuticulares não apresentaram diferenças entre as duas superfícies.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

O senso comum indica o psicólogo como o profissional mais preparado para trabalhar com a sexualidade. Raramente, entretanto, formamos psicólogos para lidar com a vida sexual em contextos que não sejam clínicos. Esse artigo sintetiza uma crítica às abordagens "sexológicas", dominantes no século XX, argumentando que a abordagem "construcionista", ao desconstruir a heteronormatividade e a subordinação da mulher como naturais, validou-se como paradigma alternativo de grande relevância para a pesquisa e a prática de profissionais que abordam a sexualidade. O construcionismo interpretou melhor novos desafios, como a epidemia da Aids, especialmente em contextos de desigualdade e violação de direitos, inspirando a prevenção baseada na análise de gênero e compreensão de cenários, cenas, scripts e trajetórias de sujeitos sexuais. O trabalho dos psicólogos será beneficiado se sua formação redescobrir a sexualidade, repensar a sexologia, superar abordagens baseadas em valores pessoais e em psicologias com pretensões universalistas, ao menos no campo da sexualidade.