1000 resultados para Aço ASTM A285 Gr C
Resumo:
The behavior of Pt/C and Pt-RuO(x)/C electrodes subjected to a larger number of potential scans and constant potential for prolonged time periods was investigated in the absence and presence of methanol. The structural changes were analyzed on the basis of the modifications observed in the X-ray diffraction pattern of the catalysts. Carbon monoxide stripping experiments were performed before and after the potential scans, thus enabling analysis of the behavior of the electrochemically active surface area. The resulting solutions were examined by inductively coupled plasma mass spectrometry (ICP-MS). There was reduction in the electrochemically active surface area, as well as increase in crystallite size and dissolution of catalyst components after the potential scan tests. Catalyst degradation was more pronounced in the presence of methanol, and cyclic potential conditions accelerate the degradation mechanisms. (C) 2010 Professor T. Nejat Veziroglu. Published by Elsevier Ltd. All rights reserved.
Resumo:
In the current work, we studied the effect of the nonionic detergent dodecyloctaethyleneglycol, C(12)E(8), on the structure and oligomeric form of the Na,K-ATPase membrane enzyme (sodium-potassium pump) in aqueous suspension, by means of small-angle X-ray scattering (SAXS). Samples composed of 2 mg/mL of Na,K-ATPase, extracted from rabbit kidney medulla, in the presence of a small amount of C(12)E(8) (0.005 mg/mL) and in larger concentrations ranging from 2.7 to 27 mg/mL did not present catalytic activity. Under this condition, an oligomerization of the alpha subunits is expected. SAXS data were analyzed by means of a global fitting procedure supposing that the scattering is due to two independent contributions: one coming from the enzyme and the other one from C(12)E(8) micelles. In the small detergent content (0.005 mg/mL), the SAXS results evidenced that Na,K-ATPase is associated into aggregates larger than (alpha beta)(2) form. When 2.7 mg/mL of C(12)E(8) is added, the data analysis revealed the presence of alpha(4) aggregates in the solution and some free micelles. Increasing the detergent amount up to 27 mg/mL does not disturb the alpha(4) aggregate: just more micelles of the same size and shape are proportionally formed in solution. We believe that our results shed light on a better understanding of how nonionic detergents induce subunit dissociation and reassembling to minimize the exposure of hydrophobic residues to the aqueous solvent.
Resumo:
p53 is known to repress transcription of a number of genes, but the mechanism of p53 recruitment to these target genes is unknown. The c-myb proto-oncogene product (c-Myb) positively regulates proliferation of immature hematopoietic cells, whereas p53 blocks cell cycle progression. Here, we demonstrate that p53 inhibits c-Myb-induced transcription and transformation by directly binding to c-Myb. The ability of c-Myb to maintain the undifferentiated state of M1 cells was also suppressed by p53. p53 did not affect the ability of c-Myb to bind to DNA but formed a ternary complex with the corepressor mSin3A and c-Myb. Thus, p53 antagonizes c-Myb by recruiting mSin3A to down-regulate specific Myb target genes.
Resumo:
Carbon-supported catalysts containing platinum and molybdenum oxide are prepared by thermal decomposition of polymeric precursors. The Pt(y)Mo(z)O(x)/C materials are characterized by energy dispersive X-ray spectroscopy, transmission electron microscopy, and X-ray diffraction. The catalysts present a well-controlled stoichiometry and nanometric particles. Molybdenum is present mainly as the MoO(3) orthorhombic structure, and no Pt alloys are detected. The voltammetric behavior of the electrodes is investigated; a correlation with literature results for PtMo/C catalysts prepared by other methods is established. The formation of soluble species and the aging effect are discussed. (C) 2009 Elsevier B.V. All rights reserved.
Resumo:
In this article we present a complete (1)H and (13)C NMR spectral analysis of three 7,7`-dihydroarylnaphthalene lignan lactones using modern NMR techniques such as COSY, HSQC, HMBC and NOE experiments. Complete assignment and homonuclear hydrogen coupling constant measurements were performed. Copyright (C) 2009 John Wiley & Sons, Ltd.
Resumo:
In this paper we discuss the existence of alpha-Holder classical solutions for non-autonomous abstract partial neutral functional differential equations. An application is considered.
Resumo:
PREDBALB/c is a computational system that predicts peptides binding to the major histocompatibility complex-2 (H2(d)) of the BALB/c mouse, an important laboratory model organism. The predictions include the complete set of H2(d) class I ( H2-K-d, H2-L-d and H2-D-d) and class II (I-E-d and I-A(d)) molecules. The prediction system utilizes quantitative matrices, which were rigorously validated using experimentally determined binders and non-binders and also by in vivo studies using viral proteins. The prediction performance of PREDBALB/c is of very high accuracy. To our knowledge, this is the first online server for the prediction of peptides binding to a complete set of major histocompatibility complex molecules in a model organism (H2(d) haplotype). PREDBALB/c is available at http://antigen.i2r.a-star.edu.sg/predBalbc/.
Resumo:
The stress corrosion cracking (SCC) behavior and pre-exposure embrittlement of AZ31 magnesium alloy have been studied by slow strain rate tensile (SSRT) tests in this paper. It is showed that AZ31 sheet material is susceptible to SCC in distilled water, ASTM D1.387 solution, 0.01 M NaCl and 0.1 M NaCl solution. The AZ31 magnesium alloy also becomes embrittled if pre-exposed to 0.01 M NaCl solution prior to tensile testing. The degree of embrittlement increased with increasing the pre-exposure time, It is proposed that both the pre-exposure embrittlement and SCC were due to hydrogen which reduces the cohesive strength. i,e,. hydrogen embrittlement, (c) 2005 Elsevier B.V. All rights reserved.
Resumo:
We describe here two new transposable elements, CemaT4 and CemaT5, that were identified within the sequenced genome of Caenorhabditis elegans using homology based searches. Five variants of CemaT4 were found, all non-autonomous and sharing 26 bp inverted terminal repeats (ITRs) and segments (152-367 bp) of sequence with similarity to the CemaT1 transposon of C. elegans. Sixteen copies of a short, 30 bp repetitive sequence, comprised entirely of an inverted repeat of the first 15 bp of CemaT4's ITR, were also found, each flanked by TA dinucleotide duplications, which are hallmarks of target site duplications of mariner-Tc transposon transpositions. The CemaT5 transposable element had no similarity to maT elements, except for sharing identical ITR sequences with CemaT3. We provide evidence that CemaT5 and CemaT3 are capable of excising from the C. elegans genome, despite neither transposon being capable of encoding a functional transposase enzyme. Presumably, these two transposons are cross-mobilised by an autonomous transposon that recognises their shared ITRs. The excisions of these and other non-autonomous elements may provide opportunities for abortive gap repair to create internal deletions and/or insert novel sequence within these transposons. The influence of non-autonomous element mobility and structural diversity on genome variation is discussed.
Resumo:
Major requirements for performance of liver biopsy (LB) are the benefits for the patient and the impossibility of having the same information by less invasive procedures. In the last two decades physicians have faced the difficult task of convincing a patient positive for hepatitis C, with minimal clinical or laboratory alterations to be submitted to LB in order to evaluate the status of the disease for therapeutic management. The characteristics of the needle used for percutaneous LB interferes with the accuracy of diagnosis. In chronic hepatitis C (CHC), validity is achieved with liver fragments about 25mm in length containing more than 10 portal tracts. Morbidity due to LB is mainly related to bleeding but death is very rare. Severe complications are also uncommon, increasing with number of passes and decreasing with experience of operator and ultrasound guidance. Although CHC is a diffuse disease, the various areas of the liver may not be equally affected and sampling errors are possible. Another potential limitation of LB is the discordance between pathologists in its interpretation. To replace LB, many panels of surrogate markers have been described, aiming to identify extent of fibrosis and inflammation. All of them have used LB as their ""gold standard"". Liver biopsy continues to be the most reliable method to evaluate the possibility of therapy for CHC. Universal treatment of all patients with diagnosis of CHC would be ideal. But, there are mainly three drawbacks. Overall efficacy is as low as 50%, side effects are common and may be severe and treatment is prolonged and expensive. The acceptability of the biopsy by the patient is highly dependent on the physician`s conviction of its usefulness.
Resumo:
The purpose of the present substudy of the Lipid Treatment Assessment Project 2 was to assess dual C-reactive protein (CRP) and low-density lipoprotein (LDL) cholesterol goal attainment across a spectrum of low-, moderate-, and high-risk patients with dyslipidemia in 8 countries in North America, Latin America, Europe, and Asia. Of the 9,518 patients studied overall, 45% were women, 64% had hypertension, 31% had diabetes, 14% were current smokers, 60% were high risk, and 79% were taking a statin. The median CRP level was 1.5 mg/L (interquartile range 0.2 to 2.8). On multivariate analysis, higher CRP levels were associated with older age, female gender, hypertension, current smoking, greater body mass index, larger waist circumference, LDL cholesterol level, and triglyceride/high-density lipoprotein cholesterol ratio. In contrast, being from Asia or taking a statin was associated with lower levels. Across all risk groups, 59% of patients attained the CRP target of <2 mg/L, and 33% had <1 mg/L. Overall, 44% of patients attained both their National Cholesterol Education Program Adult Treatment Panel III LDL cholesterol target and a CRP level of <2 mg/L, but only 26% attained their LDL cholesterol target and a CRP level of <1 mg/L. In the very high-risk group with coronary heart disease and >= 2 risk factors, only 19% attained both their LDL cholesterol goal and a CRP level of <2 mg/L and 12% their LDL cholesterol goal and a CRP level of <1 mg/L. In conclusion, with current treatment, most dyslipidemic patients do not reach the dual CRP and LDL cholesterol goals. Smoking cessation, weight reduction, and the greater use of more potent statins at higher doses might be able to improve these outcomes. (C) 2011 Elsevier Inc. All rights reserved. (Am J Cardiol 2011;107:1639-1643)
Resumo:
Chronic hepatitis C (CHC) is one of the most important causes of chronic liver disease in the world, potentially resulting in cirrhosis, hepatocellular carcinoma, and the need for liver transplantation. Liver biopsy is currently performed before therapy indication. Although, it is the golden standard there are many reasons to avoid or delay the procedure. APRI Score is an easy, low cost and practice alternative method which was described as an alternative for assessing structural changes in chronic hepatitis C (CHC). The rationale of this study was to observe the accuracy of APRI Score in comparison to liver biopsy in 400 patients divided into two groups of 200 carriers (Validation and Experimental groups respectively) selected at random or according to liver fibrosis staging (METAVIR). The ROC curves showed a concordance among these two methods of 92% and 88.5% when 1.05 was the cut off (F3 and F4), and 87% and 83%, on 0.75 cut offs (F2-F4). The discordance in advanced fibrosis staging (F3 and F4) was only 16 (8%) and 22 (11%) out of 200 patients in the experimental and validation groups, respectively. In 26 (13%) out of 200 patients in the experimental group and 34 (17%) out of 200 patients in the validation group, there was discordance between APRI Score and liver biopsy in moderate and advanced fibrosis (F2-F4). In conclusion APRI is a serological marker that has satisfactory sensitivity and specificity together with a high predictive value and it can be useful either in the absence of a biopsy or to reduce the frequency with which biopsies need to be carried out to monitor the evolution of chronic hepatitis C and the right moment for treatment indication.
Resumo:
Hepatitis C virus (HCV) is a major cause of hepatic disease and of liver transplantation worldwide. Mannan-binding lectin (MBL), encoded by the MBL2 gene, can have an important role as an opsonin and complement activating molecule in HCV persistence and liver injury. We assessed the MBL2 polymorphism in 102 Euro-Brazilian patients with moderate and severe chronic hepatitis C, paired for gender and age with 102 HCV seronegative healthy individuals. Six common single nucleotide polymorphisms in the MBL2 gene, three in the promoter (H/L, X/Y and P/Q) and three in exon 1 (A, the wild-type, and B, C or D also known as O) were evaluated using real-time polymerase chain reaction with fluorescent hybridization probes. The concentration of MBL in plasma was measured by enzyme-linked immunosorbent assay. The frequency of the YA/YO genotype was significantly higher in the HCV patients compared with the controls (P = 0.022). On the other hand, the genotypes associated with low levels of MBL (XA/XA, XA/YO and YO/YO) were decreased significantly in the patients with severe fibrosis (stage F4), when compared with the patients with moderate fibrosis (stage F2) (P = 0.04) and to the control group (P = 0.011). Furthermore, MBL2 genotypes containing X or O mutations were found to be associated with non-responsiveness to pginterferon and ribavirin treatment (P = 0.023). MBL2 polymorphisms may therefore be associated not only with the development of chronic hepatitis C, but also with its clinical evolution and response to treatment.
Resumo:
We have observed previously that Ca2+ pump-mediated Ca2+ efflux is elevated in cultured aortic smooth muscle cells from spontaneously hypertensive rats compared to those from Wistar-Kyoto rat controls. The objective of this work was to determine if these strains differ in mRNA levels for the PMCA1 isoform of the plasma membrane Ca2+-ATPase and the SERCA2 isoform of the sarcoplasmic reticulum Ca2+-ATPase. mRNA levels were compared in cultured aortic smooth muscle cells from 10-week-old male rats. PMCA1 and SERCA2 mRNA levels were elevated in SHR compared to WKY. Angiotensin II increased the level of PMCA1 and SERCA2 mRNA in both strains. These studies provide further evidence for alterered Ca2+ homeostasis in hypertension at the level of Ca2+ transporting ATPases in the spontaneously hypertensive rat model. These data are also consistent with the hypothesis that the expression of these two Ca2+ pumps may be linked. (C) 1997 Academic Press
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).