Capitalism without Capitalists? A Bottom-Up View of Industrial Transformation in East Germany. CES Germany & Europe Working Papers, No. 00.1, 1999

Research on the industrial transition in East Germany and its outcomes has long focused on the strategy of the Treuhand­ anstalt (IHA). According to institutionalists, David Stark and Lazlo Brust!: (1998), the powerful position of the German privatization agency was not only a result of German unification but also a function of a pathway rooted in the institutional peculiarities of the East German economy before 1989. This paper shows that neither a simple top-down perspective nor the pathway approach, as Stark and Brust!: suggested, are adequate for explaining the internal dynamic of enterprise transformation as well as the outcomes of this process. First of all, the dissolution of the former organizational structures and hierarchies was less coordinated by the 1HA than is often assumed. Often Kombinates fell apart more quickly from below than they could be dismantled from above since enterprises or their units chose the exit­ option and had good reasons to do so. Secondly, although the privatization by the 1HA resulted in the clear dominance of Western investors, the new ownership structure of East German industry as a whole could be characterized as a "capitalism without (East German) capitalists." In fact, what exists in East Germany is rather a kind of "small business capitalism" (KleinbetriebsknpitalifmllS) in which small-and medium-sized producers dominate the landscape. Finally, there was no single starting point in 1989. Two different industrial orders shaped the industrial history of the East German regions which were not destroyed between 1945-89, but rather transformed into the state socialist production system. It can be shown that these older historical patterns are relevant for transition and their outcomes as well.

Stem and crown dimensions as predictors of thinning responses in a crowded tropical rainforest plantation of Flindersia brayleyana F. Muell.

A 67-year-old plantation of Flindersia brayleyana F. Muell. in the wet tropics of north-cast Queensland had developed with minimal management. Before thinning, the stand had a canopy stem density of 770 stems ha(-1) of which 564 were F brayleyana, a stand basal area of 78 m(2) ha(-1), a mean stem diameter at breast height (dbh) of 36 cm, and a mean dbh increment of 5.2 mm year(-1) over the life of the plantation and 0.5 mm year I at the time of thinning. Sixty-three percent of the trees had crown ratios (crown diameter determined from foliage projected area: dbh) of less than 12. Thinning treatments removed 57% of the canopy stems and 45% of the stand basal area. Mean dbh increment over 2.5 years after thinning on basaltic soil was 5.8 +/- 0.3 mm year(-1), but for trees with crown ratio

Study of hexane adsorption in nanoporous MCM-41 silica

We study here the adsorption of hexane on nanoporous MCM-41 silica at 303, 313, and 323 K, for various pore diameters between 2.40 and 4.24 nm. Adsorption equilibria, measured thermogravimetrically, show that all the isotherms, that are somewhat akin to those of type V, exhibit remarkably sharp capillary adsorption phase transition steps and are reversible. The position of the phase transition step gradually shifts from low to high relative pressure with an increase in the temperature as well as the pore sizes. The isosteric heats of adsorption derived from the equilibrium information using the Clapeyron equation reveal a gradual decrease with increasing adsorbed amount because of the surface heterogeneity but approach a constant value near the phase transition. A decrease in the pore size results in an increase in the isosteric heat of adsorption because of the increased dispersion forces. A simple strategy, based on the Broekhoff and De Boer adsorption theory, successfully interprets the hexane adsorption isotherms for the different pore size MCM-41 samples. The parameters of an empirical expression, used to represent the potential of interaction between the adsorbate and adsorbent, are obtained by fitting the monolayer region prior to capillary condensation and the experimental phase transition simultaneously, for some pore sizes. Subsequently, the parameters are used to predict the adsorption isotherm on other pore size samples, which showed good agreement with experimental data.

A new equation for macroscopic description of capillary rise in porous media

Capillary rise in porous media is frequently modeled using the Washburn equation. Recent accurate measurements of advancing fronts clearly illustrate its failure to describe the phenomenon in the long term. The observed underprediction of the position of the front is due to the neglect of dynamic saturation gradients implicit in the formulation of the Washburn equation. We consider an approximate solution of the governing macroscopic equation, which retains these gradients, and derive new analytical formulae for the position of the advancing front, its speed of propagation, and the cumulative uptake. The new solution properly describes the capillary rise in the long term, while the Washburn equation may be recovered as a special case. (C) 2004 Elsevier Inc. All rights reserved.

Mechanisms of convective drying in thick beds of solids

The literature on heat and mass transfer mechanisms in the convective drying of thick beds of solids has been critically reviewed. Related mathematical models of heat transfer are also considered. Experimental and theoretical studies were made of the temperature distribution within beds, and of drying rates, with various materials undergoing convective drying. The experimental work covered thick beds of hygroscopic and non-hygroscopic materials (glass beads of different diameters, polystyrene pellets, activated alumina and wood powder) at air temperatures of 54°C to 84°C. Tests were carried out in a laboratory drying apparatus comprising a wind tunnel through which the air, of controlled temperature and humidity, was passed over a sample suspended from a balance. Thermocouples were inserted at different depths within the sample bed. The temperature distribution profiles for both hygroscopic and non-hygroscopic beds exhibited a clear difference between the temperatures at the surface and bottom during the constant rate period. An effective method was introduced for predicting the critical moisture content. During the falling rate the profiles showed the existence of a receding evaporation plane; this divided the system into a hotter dry zone in the upper section and a wet zone near the bottom. A graphical procedure was established to predict accurately the position of the receding evaporation front at any time. A new mathematical model, based on the receding evaporation front phenomenon, was proposed to predict temperature distributions throughout a bed during drying. Good agreement was obtained when the model was validated by comparing its predictions with experimental data. The model was also able to predict the duration of each drying stage. In experiments using sample trays of different diameters, the drying rate was found to increase with a decrease in the effective length of the bed surface. During the constant rate period with trays of a small effective length, i.e. less than 0.08 m, an 'inversion' in temperature distribution occurred in the bed; the bottom temperature increased and became greater than that of the surface. Experimental measurements were verified in several ways to ensure this phenomenon was real. Theoretical explanations are given for both the effective length and temperature inversion phenomena.

'He was like a zombie':off-label prescription of antipsychotic drugs in dementia

This paper explores the legal position of the off-label prescription of antipsychotic medications to people with dementia who experience behavioural and psychological symptoms of dementia (BPSD). Dementia is a challenging illness, and BPSD can be very difficult for carers to manage, with evidence that this contributes to carer strain and can result in the early institutionalisation of people with dementia. As a result, the prescription of antipsychotic and other neuroleptic medications to treat BPSD has become commonplace, in spite of these drugs being untested and unlicensed for use to treat older people with dementia. In recent years, it has become apparent through clinical trials that antipsychotic drugs increase the risk of cerebrovascular accident (stroke) and death in people with dementia. In addition, these types of medication also have other risk factors for people with dementia, including over-sedation and worsening of cognitive function. Drawing on recent questionnaire (n = 185), focus group (n = 15), and interview (n = 11) data with carers of people with dementia, this paper explores the law relating to off-label prescription, and the applicability of medical negligence law to cases where adverse events follow the use of antipsychotic medication. It is argued that the practice of off-label prescribing requires regulatory intervention in order to protect vulnerable patients. © The Author [2012]. Published by Oxford University Press; all rights reserved.

Physical modeling of processes of sediment transport in inlets

During the transformation of the low tide to the high tide, an exactly inverse phenomenon is occurred and the high tidal delta is formed at the mouth upstream. Increasing the tidal range does not affect the nature of this phenomenon and just change its intensity. In this situation, the inlet will be balance over time. A new relationship between equilibrium cross section and tidal prism for different tidal levels as well as sediment grading has been provided which its results are corresponded with results of numerical modeling. In the combination state, the wave height significantly affects the current and sedimentary pattern such that the wave height dimensionless index (Hw/Ht) determines the dominant parameter (the short period wave or tide) in the inlet. It is notable that in this state, the inlet will be balanced over the time. In order to calculate sedimentary phenomena, each of which are individually determined under solely wave and only tide conditions and then they are added. Estimated values are similar to numerical modeling results of the combination state considering nonlinear terms. Also, it is clear that the wave and tide performance is of meaning in the direct relationship with the water level. The water level change causes variations of the position of the breaking line and sedimentary active area. It changes the current and sedimentary pattern coastward while does not change anything seaward. Based on modeling results of sediment transport due to the wave, tide and their combination, it could be said that the erosion at the mouth due to the wave is less than that due to the wave and tide combination. In these situations, tide and wave-tide combination increase the low tidal and high tidal delta volume, respectively. Hence, tide plays an effective role in changing sedimentary phenomena at the channel and mouth downstream. Whereas, short period and combined waves have a crucial role in varying the morphology and sediment transport coast ward.

3D modelling of mango fruit skin blush in the tree canopy

The fruit of certain mango cultivars (e.g., 'Honey Gold') can develop blush on their skin. Skin blush due to red pigmentation is from the accumulation of anthocyanins. Anthocyanin biosynthesis is related to environmental determinants, including light received by the fruit. It has been observed that mango skin blush varies with position in the tree canopy. However, little investigation into this spatial relationship has been conducted. The objective of this preliminary study was to describe a 'Honey Gold' mango tree by capturing its three-dimensional (3D) architecture. A light path tracing model QuasiMC was then used to predict light received by fruit. The use of this 3D model was to better understand the relationship between mango fruit skin blush and fruit position in the canopy. The digitised mango tree mimicked the real tree at a high level of detail. Observations on mango skin blush distribution supported the proposition that sunlight exposure is an absolute requirement for anthocyanin development. No blush development occurred on shaded skin. It was affirmed that 3D mapping could allow for virtual experiments. For example, for virtual canopy thinning (e.g., 'window pruning') to admit more sunlight with a view to improve fruit blush. Improvements to 3D modelling of mango skin blush could focus on increasing accuracy, e.g., measurement of leaf light reflectance and transmission and the inclusion of the effect shading by branches.

Harvesting fruit of equivalent chronological age and fruit position shows individual effects of UV radiation on aspects of the strawberry ripening process

The effect of UV radiation on fruit secondary compounds of strawberry cv ‘Elsanta’ was recorded taking chronological age and fruit position on the truss into account. When fruit of similar age post-anthesis, and truss position were compared, we found that the concentration of secondary compounds differed according to fruit position on the truss. UV radiation hastened the rate of colour development and resulted in an increase in fruit anthocyanin (14–31%), flavonoid (9–21%) and phenolic (9–20%) contents at harvesting; but it had no effect on fruit soluble solid content, pH and volatile composition. It did, however, increase leaf flavonoid (16%) and phenolic (8%) concentrations. Fruit ripened under a UV transparent film were firmer, smaller but greater in number than fruit ripened under a UV opaque film. Overall, the results indicate that UV radiation does not affect all aspects of strawberry ripening but independently alters rate of colour development and fruit firmness

An Allele of the Ripening-Specific 1-Aminocyclopropane-1-Carboxylic Acid Synthase Gene (ACS1) in Apple Fruit with a Long Storage Life1

An allele of the 1-aminocyclopropane-1-carboxylic acid (ACC) synthase gene (Md-ACS1), the transcript and translated product of which have been identified in ripening apples (Malus domestica), was isolated from a genomic library of the apple cultivar, Golden Delicious. The predicted coding region of this allele (ACS1-2) showed that seven nucleotide substitutions in the corresponding region of ACS1-1 resulted in just one amino acid transition. A 162-bp sequence characterized as a short interspersed repetitive element retrotransposon was inserted in the 5′-flanking region of ACS1-2 corresponding to position −781 in ACS1-1. The XhoI site located near the 3′ end of the predicted coding region of ACS1-2 was absent from the reverse transcriptase-polymerase chain reaction product, revealing that exclusive transcription from ACS1-1 occurs during ripening of cv Golden Delicious fruit. DNA gel-blot and polymerase chain reaction analyses of genomic DNAs showed clearly that apple cultivars were either heterozygous for ACS1-1 and ACS1-2 or homozygous for each type. RNA gel-blot analysis of the ACS1-2 homozygous Fuji apple, which produces little ethylene and has a long storage life, demonstrated that the level of transcription from ACS1-2 during the ripening stage was very low.

Visual Navigation In The Neotropical Ant Odontomachus Hastatus (formicidae, Ponerinae), A Predominantly Nocturnal, Canopy-dwelling Predator Of The Atlantic Rainforest.

The arboreal ant Odontomachus hastatus nests among roots of epiphytic bromeliads in the sandy forest at Cardoso Island (Brazil). Crepuscular and nocturnal foragers travel up to 8m to search for arthropod prey in the canopy, where silhouettes of leaves and branches potentially provide directional information. We investigated the relevance of visual cues (canopy, horizon patterns) during navigation in O. hastatus. Laboratory experiments using a captive ant colony and a round foraging arena revealed that an artificial canopy pattern above the ants and horizon visual marks are effective orientation cues for homing O. hastatus. On the other hand, foragers that were only given a tridimensional landmark (cylinder) or chemical marks were unable to home correctly. Navigation by visual cues in O. hastatus is in accordance with other diurnal arboreal ants. Nocturnal luminosity (moon, stars) is apparently sufficient to produce contrasting silhouettes from the canopy and surrounding vegetation, thus providing orientation cues. Contrary to the plain floor of the round arena, chemical cues may be important for marking bifurcated arboreal routes. This experimental demonstration of the use of visual cues by a predominantly nocturnal arboreal ant provides important information for comparative studies on the evolution of spatial orientation behavior in ants. This article is part of a Special Issue entitled: Neotropical Behaviour.

Modeling The Effects Of Temperature And Ph On The Resistance Of Alicyclobacillus Acidoterrestris In Conventional Heat-treated Fruit Beverages Through A Meta-analysis Approach.

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.