851 resultados para Meaning in Life Scale


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The use of chemical control measures to reduce the impact of parasite and pest species has frequently resulted in the development of resistance. Thus, resistance management has become a key concern in human and veterinary medicine, and in agricultural production. Although it is known that factors such as gene flow between susceptible and resistant populations, drug type, application methods, and costs of resistance can affect the rate of resistance evolution, less is known about the impacts of density-dependent eco-evolutionary processes that could be altered by drug-induced mortality. The overall aim of this thesis was to take an experimental evolution approach to assess how life history traits respond to drug selection, using a free-living dioecious worm (Caenorhabditis remanei) as a model. In Chapter 2, I defined the relationship between C. remanei survival and Ivermectin dose over a range of concentrations, in order to control the intensity of selection used in the selection experiment described in Chapter 4. The dose-response data were also used to appraise curve-fitting methods, using Akaike Information Criterion (AIC) model selection to compare a series of nonlinear models. The type of model fitted to the dose response data had a significant effect on the estimates of LD50 and LD99, suggesting that failure to fit an appropriate model could give misleading estimates of resistance status. In addition, simulated data were used to establish that a potential cost of resistance could be predicted by comparing survival at the upper asymptote of dose-response curves for resistant and susceptible populations, even when differences were as low as 4%. This approach to dose-response modeling ensures that the maximum amount of useful information relating to resistance is gathered in one study. In Chapter 3, I asked how simulations could be used to inform important design choices used in selection experiments. Specifically, I focused on the effects of both within- and between-line variation on estimated power, when detecting small, medium and large effect sizes. Using mixed-effect models on simulated data, I demonstrated that commonly used designs with realistic levels of variation could be underpowered for substantial effect sizes. Thus, use of simulation-based power analysis provides an effective way to avoid under or overpowering a study designs incorporating variation due to random effects. In Chapter 4, I 3 investigated how Ivermectin dosage and changes in population density affect the rate of resistance evolution. I exposed replicate lines of C. remanei to two doses of Ivermectin (high and low) to assess relative survival of lines selected in drug-treated environments compared to untreated controls over 10 generations. Additionally, I maintained lines where mortality was imposed randomly to control for differences in density between drug treatments and to distinguish between the evolutionary consequences of drug treatment versus ecological processes affected by changes in density-dependent feedback. Intriguingly, both drug-selected and random-mortality lines showed an increase in survivorship when challenged with Ivermectin; the magnitude of this increase varied with the intensity of selection and life-history stage. The results suggest that interactions between density-dependent processes and life history may mediate evolved changes in susceptibility to control measures, which could result in misleading conclusions about the evolution of heritable resistance following drug treatment. In Chapter 5, I investigated whether the apparent changes in drug susceptibility found in Chapter 4 were related to evolved changes in life-history of C. remanei populations after selection in drug-treated and random-mortality environments. Rapid passage of lines in the drug-free environment had no effect on the measured life-history traits. In the drug-free environment, adult size and fecundity of drug-selected lines increased compared to the controls but drug selection did not affect lifespan. In the treated environment, drug-selected lines showed increased lifespan and fecundity relative to controls. Adult size of randomly culled lines responded in a similar way to drug-selected lines in the drug-free environment, but no change in fecundity or lifespan was observed in either environment. The results suggest that life histories of nematodes can respond to selection as a result of the application of control measures. Failure to take these responses into account when applying control measures could result in adverse outcomes, such as larger and more fecund parasites, as well as over-estimation of the development of genetically controlled resistance. In conclusion, my thesis shows that there may be a complex relationship between drug selection, density-dependent regulatory processes and life history of populations challenged with control measures. This relationship could have implications for how resistance is monitored and managed if life histories of parasitic species show such eco-evolutionary responses to drug application.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Background There is increasing international interest in the concept of mental well-being and its contribution to all aspects of human life. Demand for instruments to monitor mental well-being at a population level and evaluate mental health promotion initiatives is growing. This article describes the development and validation of a new scale, comprised only of positively worded items relating to different aspects of positive mental health: the Warwick-Edinburgh Mental Well-Being Scale (WEMWBS). Methods WEMWBS was developed by an expert panel drawing on current academic literature, qualitative research with focus groups, and psychometric testing of an existing scale. It was validated on a student and representative population sample. Content validity was assessed by reviewing the frequency of complete responses and the distribution of responses to each item. Confirmatory factor analysis was used to test the hypothesis that the scale measured a single construct. Internal consistency was assessed using Cronbach’s alpha. Criterion validity was explored in terms of correlations between WEMWBS and other scales and by testing whether the scale discriminated between population groups in line with pre-specified hypotheses. Test-retest reliability was assessed at one week using intra-class correlation coefficients. Susceptibility to bias was measured using the Balanced Inventory of Desired Responding. Results WEMWBS showed good content validity. Confirmatory factor analysis supported the single factor hypothesis. A Cronbach’s alpha score of 0.89 (student sample) and 0.91 (population sample) suggests some item redundancy in the scale. WEMWBS showed high correlations with other mental health and well-being scales and lower correlations with scales measuring overall health. Its distribution was near normal and the scale did not show ceiling effects in a population sample. It discriminated between population groups in a way that is largely consistent with the results of other population surveys. Test–retest reliability at one week was high (0.83). Social desirability bias was lower or similar to that of other comparable scales. Conclusions WEMWBS is a measure of mental well-being focusing entirely on positive aspects of mental health. As a short and psychometrically robust scale, with no ceiling effects in a population sample, it offers promise as a tool for monitoring mental well-being at a population level. Whilst WEMWBS should appeal to those evaluating mental health promotion initiatives, it is important that the scale’s sensitivity to change is established before it is recommended in this context.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

International audience

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Background: Diabetes imposes restrictions on physical, emotional, and social functioning of children and adolescents. Objectives: The aim of this study was to determine effectiveness of acceptance and commitment therapy (ACT) for depression, psychological well-being and feeling of guilt in 7 - 15 years old diabetic children. Patients and Methods: This was a clinical trial with pre-test and post-test design with control group. The study population consisted of 34 participants selected using convenient sampling out of all 7 - 15 years old patients that referred to the Diabetes Association of Tabriz. They were randomly allocated into two equal groups (experimental and control). The experimental group participated in therapy sessions and the control group did not receive any intervention. The research instruments were reynolds child depression scale (RCDS), eysenck feelings of guilt scale and satisfaction with life scale (SWLS). Results: Multivariate covariance analysis (MANCOVA) showed that the treatment was effective on variables of depression, psychological well-being and feeling guilty in 7 - 15 years old diabetic children (P < 0.001). Conclusions: The aforementioned treatment is effective and suggested to be used in other psychosomatic diseases of children.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This dissertation makes a contribution to the growing literature on identity formation by formulating, implementing, and testing the effectiveness of a psychosocial intervention, the Making Life Choices (MLC) Workshops, designed to facilitate the process of identity formation. More specifically, the MLC Workshops were designed to foster the development and use of critical cognitive and communicative skills and competencies in choosing and fulfilling life goals and values. The MLC Workshops consist of a psychosocial group intervention that includes both didactic and group experiential exercises. The primary research question for this study concerned the effectiveness of the MLC Workshop relative to a control condition. Effectiveness was evaluated on two levels: skills development and reduction of distress. First, the effectiveness of MLC in fostering the development of critical competencies was evaluated relative to a control condition, and no statistically significant differences were found. Second, the effectiveness of MLC in decreasing life distress was also evaluated relative to the control condition. While participants in the MLC workshop had no significant decrease in distress, they did have statistically significant improvement in life satisfaction in the Personal Domain.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The purpose of this study was to explore the role of existential beliefs in mediating the influence of health on centenarians' well-being. A total of 80 centenarians (mean age 101.1; SD = 1.3; 81.3 % women) with no/minor cognitive impairment were included. The OARS questionnaire for diseases and functional capacity (ADL, IADL), the Satisfaction with Life Scale, and the existential beliefs subscale were used for data collection. The findings suggest that existential resources are a crucial element for mitigating the impact of health constraints in subjective well-being in this population. Appropriate models of intervention for very old age that recognize the importance of religion, spirituality, and meaning of life are to be considered.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The Quality of life is currently a major topic discussed in our society. The World Health Organization (WHO) has been developing a unifying and transcultural definition of QOL. They considered it as 'the individual's perception of his or her position in life, within the cultural context and value system he or she lives in, and in relation to his or her goals, expectations, parameters and social relations. It is a broad ranging concept affected in a complex way by the person's physical health, psychological state, level of independence, social relationships and their relationship to salient features of their environment (WHOQOL, 1997, p. 1). Congenital heart disease is the most prevalent congenital disease in Portugal. Despite the advances in cardiac treatment and an early correct diagnosis that could increase the survival of children with congenital heart disease, this condition influences the quality of life of children, adolescents and their parents. Knowing the perception of quality of life could help healthcare professionals, nurses in particular, providing suited care to the needs of these families, establishing priorities in their interventions, sensing predictors of a poor quality of life, promoting adherence to treatment and boosting compliance with treatment, and fostering greater satisfaction for these children, adolescents and their parents. Purpose As part of broader research and with the awareness that the chronic conditions could impact the quality of life and considering that all advances on treating congenital cardiac diseases we have defined this main objective: To determine the quality of life in children and adolescents with congenital heart disease (CHD) and the perception of their parents, as well as factors that influence it. Methods It is a quantitative, descriptive and correlational research. The data collection tool was a questionnaire, which consisted of four parts: socio-demographic and educational characteristics, clinical characteristics, and quality of life, obtained using the Pediatric Cardiac Quality of Life Inventory - PCQLI - (Marino, Tomlinson, Wernovsky, Drotar , Newburger, Mahony et al., 2010) translated into Portuguese. Data collection took place between February and July 2014, in compliance with ethical research guidelines. The sample comprised 59 children, 59 parents of children, 80 adolescents and 80 parents of adolescents. Results The results indicated that children, adolescents, and their parents have high level of perceived health. The results are similar in all groups: children and parents and adolescents and parents. In the group of children, we observed the classification of "Good" in 66.10%, followed by the "Very Good" at 18.65% and "fair" in 15.25% of cases. The parents of the children responded in about half the cases that the health of their children was "good" (50.85%), "very good" in 30.51% "fair" in 11.86% and "Excellent "in 6.78%. In turn, the group of adolescents can be seen that 46.25% rate their health as "good", 32.50% as "very good", 16.25% as "Average" and 5% as "Excellent". Parents of teenagers classify the health of their children mostly as "good" in 42.50%, 31.25% as "very good", 20% as "fair" and 6.25% as "excellent". To point out that none of the respondents pointed out the option of a health status "Bad". About the quality of life, in general the results indicated that children, adolescents and their parents have high levels of quality of life, and that perceptions of parents and children are similar. Only in the children's group (8 to 12 years old), was no influence of socio-demographic, school or clinical variables on quality of life observed. For adolescents (13 to 18 years old), school, special education, school retention, the age of diagnosis of congenital heart disease, cardiac catheterization and surgical intervention influenced their quality of life. Perception of quality of life of parents of children and of adolescents was influenced by socio-demographic and clinical variables. The results partly agree with the literature in this field. About the influence of some variables: - The perception of quality of life expressed by children and adolescents with congenital heart disease and parents are related, with statistical significance. - There were no statistically significant relationships between the quality of life of children and adolescents and their age, gender or socioeconomic status. - Adolescents differ statistically significant between their quality of life and their education, the frequency of special education and the existence of grade retention. The severity of heart disease, the number of cardiac catheterizations or surgery and the presence of other health disorders are unrelated to the quality of life of children and adolescents. - Adolescents revealed that the level of quality of life is influenced by the age of diagnosis of CHD by cardiac catheterization and surgery. - For parents of children and adolescents gender and their education don´t influence their perception of quality of life. Only the socioeconomic status of parents of teens has statistically significant difference to quality of life. - Parents of children and adolescents do not show statistically significant relationship between the perceived level of quality of life and severity of disease, age at diagnosis, the number of surgical interventions and the existence of other health disorders. - There is a relationship of statistical significance between cardiac catheterization and the perceived quality of life by parents of adolescents; between the number of cardiac catheterizations and the perception of quality of life of parents of children; and between performing surgery and the perception of parents of children and adolescents. Conclusion To analyze the quality of life of children and adolescents with CHD must be a key focus of attention in caring for this population, allowing the identification of individual differences, interests, preferences, and prevent potential problems. The knowledge acquired along with clinical experience contributes to improve the quality of life of children and families, facilitating their growth, psycho-emotional development and social integration. Nevertheless, the reading and interpretation of these results must be prudent and cautious, there are limitations to this research, including: the use of a range of specific quality of life for the Congenital heart disease in children, adolescents, and parents but whose validation process could not be completed in this study; the low prevalence of severe conditions in our sample; the absence of national studies to enable comparison with the results obtained. We intend to continue the process of validation of instrument and enlarge the research to Lisbon and Oporto, other major centers where the cardiac conditions can be treated

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Purpose: The Quality of life is currently a major topic discussed in our society. The World Health Organization (WHO) has been developing a unifying and transcultural definition of QOL. They considered it as 'the individual's perception of his or her position in life, within the cultural context and value system he or she lives in, and in relation to his or her goals, expectations, parameters and social relations. It is a broad ranging concept affected in a complex way by the person's physical health, psychological state, level of independence, social relationships and their relationship to salient features of their environment (WHOQOL, 1997, p. 1). Congenital heart disease is the most prevalent congenital disease in Portugal. Despite the advances in cardiac treatment and an early correct diagnosis that could increase the survival of children with congenital heart disease, this condition influences the quality of life of children, adolescents and their parents. Knowing the perception of quality of life could help healthcare professionals, nurses in particular, providing suited care to the needs of these families, establishing priorities in their interventions, sensing predictors of a poor quality of life, promoting adherence to treatment and boosting compliance with treatment, and fostering greater satisfaction for these children, adolescents and their parents. 'As part of broader research and with the awareness that the chronic conditions could impact the quality of life and considering that all advances on treating congenital cardiac diseases we have defined this main objective: To determine the quality of life in children and adolescents with congenital heart disease (CHD) and the perception of their parents, as well as factors that influence it. Methods: It is a quantitative, descriptive and correlational research. The data collection tool was a questionnaire, which consisted of four parts: socio-demographic and educational characteristics, clinical characteristics, and quality of life, obtained using the Pediatric Cardiac Quality of Life Inventory ? PCQLI - (Marino, Tomlinson, Wernovsky, Drotar , Newburger, Mahony et al., 2010) translated into Portuguese. Data collection took place between February and July 2014, in compliance with ethical research guidelines. The sample comprised 59 children, 59 parents of children, 80 adolescents and 80 parents of adolescents. Results: The results indicated that children, adolescents, and their parents have high level of perceived health. The results are similar in all groups: children and parents and adolescents and parents. In the group of children, we observed the classification of "Good" in 66.10%, followed by the "Very Good" at 18.65% and "fair" in 15.25% of cases. The parents of the children responded in about half the cases that the health of their children was "good" (50.85%), "very good" in 30.51% "fair" in 11.86% and "Excellent "in 6.78%. In turn, the group of adolescents can be seen that 46.25% rate their health as "good", 32.50% as "very good", 16.25% as "Average" and 5% as "Excellent". Parents of teenagers classify the health of their children mostly as "good" in 42.50%, 31.25% as "very good", 20% as "fair" and 6.25% as "excellent". To point out that none of the respondents pointed out the option of a health status "Bad". About the quality of life, in general the results indicated that children, adolescents and their parents have high levels of quality of life, and that perceptions of parents and children are similar. Only in the children?s group (8 to 12 years old), was no influence of socio-demographic, school or clinical variables on quality of life observed. For adolescents (13 to 18 years old), school, special education, school retention, the age of diagnosis of congenital heart disease, cardiac catheterization and surgical intervention influenced their quality of life. Perception of quality of life of parents of children and of adolescents was influenced by socio-demographic and clinical variables. The results partly agree with the literature in this field. About the influence of some variables: The perception of quality of life expressed by children and adolescents with congenital heart disease and parents are related, with statistical significance. There were no statistically significant relationships between the quality of life of children and adolescents and their age, gender or socioeconomic status. Adolescents differ statistically significant between their quality of life and their education, the frequency of special education and the existence of grade retention. The severity of heart disease, the number of cardiac catheterizations or surgery and the presence of other health disorders are unrelated to the quality of life of children and adolescents. Adolescents revealed that the level of quality of life is influenced by the age of diagnosis of CHD by cardiac catheterization and surgery. For parents of children and adolescents gender and their education don?t influence their perception of quality of life. Only the socioeconomic status of parents of teens has statistically significant difference to quality of life. Parents of children and adolescents do not show statistically significant relationship between the perceived level of quality of life and severity of disease, age at diagnosis, the number of surgical interventions and the existence of other health disorders. There is a relationship of statistical significance between cardiac catheterization and the perceived quality of life by parents of adolescents; between the number of cardiac catheterizations and the perception of quality of life of parents of children; and between performing surgery and the perception of parents of children and adolescents. Conclusion: To analyze the quality of life of children and adolescents with CHD must be a key focus of attention in caring for this population, allowing the identification of individual differences, interests, preferences, and prevent potential problems. The knowledge acquired along with clinical experience contributes to improve the quality of life of children and families, facilitating their growth, psycho-emotional development and social integration. Nevertheless, the reading and interpretation of these results must be prudent and cautious, there are limitations to this research, including: the use of a range of specific quality of life for the Congenital heart disease in children, adolescents, and parents but whose validation process could not be completed in this study; the low prevalence of severe conditions in our sample; the absence of national studies to enable comparison with the results obtained. We intend to continue the process of validation of instrument and enlarge the research to Lisbon and Oporto, other major centers where the cardiac conditions can be treated.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Este trabalho apresenta um estudo da influência de diferentes materiais de cobertura no conforto térmico de instalações destinadas à criação de frangos de corte. A pesquisa foi desenvolvida no Câmpus Experimental da UNESP de Dracena - SP. Quatro protótipos em escala real foram construídos, com área de 28 m² cada, cobertos com telha reciclada à base de embalagens longa vida, telha cerâmica, telha cerâmica pintada de branco e telha de fibrocimento. Os dados foram coletados durante o período de inverno de 2007, totalizando 90 dias. Com esses dados, foram calculados os índices de conforto térmico Carga Térmica Radiante (CTR) e a variável ambiental (Ta). Uma análise estatística por inferência e descritiva foi realizada com os valores do índice de conforto térmico e da variável ambiental. Com os resultados obtidos, é possível afirmar que a telha reciclada apresentou índices de conforto térmico semelhantes àqueles encontrados para as telhas cerâmicas. O protótipo coberto com telha de fibrocimento apresentou os maiores índices, e o coberto com telha cerâmica branca, os menores índices de conforto térmico. No entanto para o período de inverno e para os horários avaliados, todas as instalações apresentaram índices de conforto térmico fora da zona de termoneutralidade do frango de corte.