989 resultados para (Gtg)5-pcr


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Previous studies on the role of inflammation in the pathophysiology of sickle cell disease (SCD) suggested that the CCR5Δ32 allele, which is responsible for the production of truncated C-C chemokine receptor type 5 (CCR5), could confer a selective advantage on patients with SCD because it leads to a less efficient Th1 response. We determined the frequency of the CCR5Δ32 polymorphism in 795 Afro-Brazilian SCD patients followed up at the Pernambuco Hematology and Hemotherapy Center, in Northeastern Brazil, divided into a pediatric group (3 months-17 years, n = 483) and an adult group (18-70 years, n = 312). The adult patients were also compared to a healthy control group (blood donors, 18-61 years, n = 247). The CCR5/CCR5Δ32 polymorphism was determined by allele-specific PCR. No homozygous patient for the CCR5Δ32 allele was detected. The frequency of heterozygotes in the study population (patients and controls) was 5.8%, in the total SCD patients 5.1%, in the children 5.4%, in the adults with SCD 4.8%, and in the adult controls 8.1%. These differences did not reach statistical significance. Our findings failed to demonstrate an important role of the CCR5Δ32 allele in the population sample studied here.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Resistant hypertension (RHTN) is a multifactorial disease characterized by blood pressure (BP) levels above goal (140/90 mmHg) in spite of the concurrent use of three or more antihypertensive drugs of different classes. Moreover, it is well known that RHTN subjects have high prevalence of left ventricular diastolic dysfunction (LVDD), which leads to increased risk of heart failure progression. This review gathers data from studies evaluating the effects of phosphodiesterase-5 (PDE-5) inhibitors (administration of acute sildenafil and short-term tadalafil) on diastolic function, biochemical and hemodynamic parameters in patients with RHTN. Acute study with sildenafil treatment found that inhibition of PDE-5 improved hemodynamic parameters and diastolic relaxation. In addition, short-term study with the use of tadalafil demonstrated improvement of LVDD, cGMP and BNP-32 levels, regardless of BP reduction. No endothelial function changes were observed in the studies. The findings of acute and short-term studies revealed potential therapeutic effects of IPDE-5 drugs on LVDD in RHTN patients.A Hipertensão arterial resistente (HAR) é uma doença multifatorial caracterizada por níveis pressóricos acima das metas (140/90 mmHg), a despeito de tratamento farmacológico otimizado de 3 ou mais fármacos anti-hipertensivos de diferentes classes. Pacientes diagnosticados como hipertensos resistentes apresentam alta prevalência de disfunção diastólica do ventrículo esquerdo (DDVE) que proporciona risco aumentado para insuficiência cardíaca. Esta revisão reúne dados de estudos prévios avaliando os efeitos dos inibidores de fosfodiesterase-5 (PDE-5) (administração aguda de sildenafil e de curto prazo de tadalafil) na função diastólica e nos parâmetros bioquímicos e hemodinâmicos em pacientes com HAR. O estudo agudo com sildenafil demonstrou que a inibição da PDE-5 melhorou os parâmetros hemodinâmicos e de relaxamento diastólico. Além disso, o estudo curto prazo com o uso de tadalafil revelou melhora da DDVE e dos níveis de GMPc e BNP-32, independente de redução de pressão arterial. A função endotelial não apresentou alteração com ambos os tratamentos. Os resultados dos estudos agudo e de curto prazo sugerem efeitos terapêuticos potenciais dos fármacos inibidores da PDE-5 na disfunção diastólica em pacientes com HAR.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

High levels of substrate-based 1,5-stereoinduction are obtained in the boron-mediated aldol reactions of beta-oxygenated methyl ketones with achiral and chiral aldehydes. Remote induction from the boron enolates gives the 1,5-anti adducts, with the enolate pi-facial selectivity critically dependent upon the nature of the beta-alkoxy protecting group. This 1,5-anti aldol methodology has been strategically employed in the total synthesis of several natural products. At present, the origin of the high level of 1,5-anti induction obtained with the boron enolates is unclear, although a model based on a hydrogen bonding between the alkoxy oxygen and the formyl hydrogen has been recently proposed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

An efficient synthesis of the marine metabolite 3-bromoverongiaquinol (1) and the first total synthesis of 5-monobromocavernicolin (2), both isolated from the marine sponge Aplysina cavernicola, have been described based on the 1,2 addition of the lithium enolate of N,O-bistrimethylsilylacetamide (BSA, 4) to 1,4-benzoquinone (3). Bromination and purification of the crude product on silica gel chromatography provided 3-bromoverongiaquinol (1) in 50% overall yield. Under alkaline conditions, the crude product of the bromination reaction was converted to 5-monobromocavernicolin (2) in 20% yield which was also obtained in 13% yield (25% yield based on recovered starting material) from 3-bromoverongiaquinol (1).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of this work was to compare the soybean crop mapping in the western of Parana State by MODIS/Terra and TM/Landsat 5 images. Firstly, it was generated a soybean crop mask using six TM images covering the crop season, which was used as a reference. The images were submitted to Parallelepiped and Maximum Likelihood digital classification algorithms, followed by visual inspection. Four MODIS images, covering the vegetative peak, were classified using the Parallelepiped method. The quality assessment of MODIS and TM classification was carried out through an Error Matrix, considering 100 sample points between soybean or not soybean, randomly allocated in each of the eight municipalities within the study area. The results showed that both the Overall Classification (OC) and the Kappa Index (KI) have produced values ranging from 0.55 to 0.80, considered good to very good performances, either in TM or MODIS images. When OC and KI, from both sensors were compared, it wasn't found no statistical difference between them. The soybean mapping, using MODIS, has produced 70% of reliance in terms of users. The main conclusion is that the mapping of soybean by MODIS is feasible, with the advantage to have better temporal resolution than Landsat, and to be available on the internet, free of charge.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of this study was to analyze changes in the spectral behavior of the soybean crop through spectral profiles of the vegetation indexes NDVI and GVI, expressed by different physical values such as apparent bi-directional reflectance factor (BRF), surface BRF, and normalized BRF derived from images of the Landsat 5/TM. A soybean area located in Cascavel, Paraná, was monitored by using five images of Landsat 5/TM during the 2004/2005 harvesting season. The images were submitted to radiometric transformation, atmospheric correction and normalization, determining physical values of apparent BRF, surface BRF and normalized BRF. NDVI and GVI images were generated in order to distinguish the soybean biomass spectral response. The treatments showed different results for apparent, surface and normalized BRF. Through the profiles of average NDVI and GVI, it was possible to monitor the entire soybean cycle, characterizing its development. It was also observed that the data from normalized BRF negatively affected the spectral curve of soybean crop, mainly, during the phase of vegetative growth, in the 12-9-2004 image.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

PURPOSE: This study evaluated the quality of DNA obtained from stored human saliva and its applicability to human identification. METHODS: The saliva samples of 20 subjects, collected in the form of saliva in natura and from mouth swabs and stored at -20ºC, were analyzed. After 7 days, the DNA was extracted from the 40 saliva samples and subjected to PCR and electrophoresis. After 180 days, the technique was repeated with the 20 swab samples. RESULTS: The first-stage results indicated that DNA was successfully extracted in 97.5% of reactions, 95% of saliva in natura and 100% of swab saliva samples, with no statistically significant difference between the forms of saliva. In the second phase, the result was positive for all 20 analyzed samples (100%). Subsequently, in order to analyze the quality of the DNA obtained from human saliva, the SIX3-2 gene was tested on the 20 mouth swab samples, and the PCR products were digested using the MbO1 restriction enzyme to evaluate polymorphisms in the ADRA-2 gene, with positive results for most samples. CONCLUSION: It was concluded that the quantity and quality of DNA from saliva and the techniques employed are adequate for forensic analysis of DNA.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study analyzed the association of periodontal disease (PD) and rheumatoid arthritis (RA). Seventy-five 35-60-year-old patients were assigned to 5 groups according to the presence (+) or not (-) of PD and RA and the treatment received (TR+) or not (TR-) for PD. Group 3 uses total prosthesis (TP). Clinical and laboratory evaluations were performed at baseline, 3 and 6 months of follow-up by probing pocket depth, bleeding on probing and plaque index for PD, HAQ, DAS28, SF-36 and laboratory: AAG, ESR, CRP for RA. Statistically significant differences for PD after 3 (p=0.0055) and after 6 months (p=0.0066) were obtained in Group 1 (RA+PD+TR+) and 2(RA+PD+TR-); significant reduction in the % of BOP after 6 months (p=0.0128) and significant reduction in the % of Pl after 3 (p=0.0128) and 6 months (p=0.0002) in Group 1. Statistically significant differences between Groups 1 and 3 (RA+TP) for DAS28 at baseline and after 3 months were observed, but not after 6 months. No other parameters for RA were significantly affected. The relationship between RA and PD disease activities is not clear, but the importance of periodontal treatment in the control of inflammation to avoid tooth extraction is evident.