986 resultados para entomogenous fungus
Resumo:
In this work, we discuss the use of multi-way principal component analysis combined with comprehensive two-dimensional gas chromatography to study the volatile metabolites of the saprophytic fungus Memnoniella sp. isolated in vivo by headspace solid-phase microextraction. This fungus has been identified as having the ability to induce plant resistance against pathogens, possibly through its volatile metabolites. Adequate culture media was inoculated, and its headspace was then sampled with a solid-phase microextraction fiber and chromatographed every 24 h over seven days. The raw chromatogram processing using multi-way principal component analysis allowed the determination of the inoculation period, during which the concentration of volatile metabolites was maximized, as well as the discrimination of the appropriate peaks from the complex culture media background. Several volatile metabolites not previously described in the literature on biocontrol fungi were observed, as well as sesquiterpenes and aliphatic alcohols. These results stress that, due to the complexity of multidimensional chromatographic data, multivariate tools might be mandatory even for apparently trivial tasks, such as the determination of the temporal profile of metabolite production and extinction. However, when compared with conventional gas chromatography, the complex data processing yields a considerable improvement in the information obtained from the samples. This article is protected by copyright. All rights reserved.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
A ferrugem asiática, causada pelo fungo Phakopsora pachyrhizi, apresenta-se como um dos mais graves problemas fitossanitários da cultura da soja no Brasil, principalmente por não existirem, até o presente momento, cultivares com níveis de resistência satisfatórios. Objetivou-se estudar a influência da luminosidade e da camada de cera das superfícies foliares na infecção de folhas de soja por P. pachyrhizi. A superfície adaxial ou abaxial de folíolos do primeiro trifólio de plantas da cultivar BRS 154, estádio fenológico V2, foi inoculada com suspensão de 10(5) urediniósporos/mL-1. As plantas foram mantidas por 24 horas em câmara úmida e temperatura de 23ºC, sob luz ou escuro, em delineamento fatorial. Posteriormente, permaneceram 14 dias em fotoperíodo de 12 horas, sendo em seguida avaliada a densidade de lesões e a severidade da doença. Em um segundo experimento, avaliou-se in vitro , no escuro e na luz, a porcentagem de germinação de urediniósporos e de formação de apressórios. As camadas de cera adaxial e abaxial dos folíolos foram analisadas quantitativamente (extrações com clorofórmio) e estruturalmente (microscopia eletrônica de varredura). A densidade de lesões e a severidade foram maiores quando se inoculou a superfície adaxial de plantas incubadas no escuro, sem interação significativa entre os fatores. A germinação dos esporos no escuro (40,7%) foi significativamente superior à germinação na luz (28,5%). O mesmo ocorreu para a formação de apressórios, no escuro (24,7%) e na luz (12,8%). A quantidade e a estrutura das ceras epicuticulares não apresentaram diferenças entre as duas superfícies.
Resumo:
Extracts obtained from 57 marine-derived fungal strains were analyzed by HPLC-PDA, TLC and ¹H NMR. The analyses showed that the growth conditions affected the chemical profile of crude extracts. Furthermore, the majority of fungal strains which produced either bioactive of chemically distinctive crude extracts have been isolated from sediments or marine algae. The chemical investigation of the antimycobacterial and cytotoxic crude extract obtained from two strains of the fungus Beauveria felina have yielded cyclodepsipeptides related to destruxins. The present approach constitutes a valuable tool for the selection of fungal strains that produce chemically interesting or biologically active secondary metabolites.
Resumo:
Paracoccidioides brasiliensis causes paracoccidioidomycosis (PCM) that is one of the most prevalent systemic human mycoses in Latin America. Armadillos show a high incidence of PCM infection and could, therefore, be a natural reservoir for this fungus. In this study were compared the virulence profiles of isolates obtained from nine-banded armadillos (Dasypus novemcinctus) (PbT1 and PbT4) and isolates from PCM patients (Pb265 and Bt83). Pathogenicity was evaluated by fungal load and analysis of colony morphology. Immunity against the fungus was tested by delayed type hypersensitivity test (DTH) and antibody quantification by ELISA. The higher virulence of PbT1 and PbT4 was suggested by higher fungal load in spleen and lungs. Armadillo isolates and Bt83 presented a cotton-like surface contrasting with the cerebriform appearance of Pb265. All isolates induced cellular and humoral immune responses in infected BALB/c mice. DTH reactions were similarly induced by the four isolates, however, a great variability was observed in specific antibody levels, being the highest ones induced by Bt83 and PbT4. The present work confirms that armadillos harbor P. brasiliensis, whose multiplication and induced immunity in experimentally infected mice are heterogeneous, resembling the behavior of isolates from human PCM. This study reinforces the possibility that armadillos play an important role in the biological cycle of this pathogen.
Resumo:
The larva of Atractocerus brasiliensis (Lepeletier & Audinet-Serville, 1825), collected for the first time in Pinus oocarpa Schiede ex Schltdl. (Pinaceae) is described and illustrated. Until now, for Lymexylidae, only the larva of Melittomma sp. (Melittomminae) was known from the neotropical region (Brazil). Biological notes, a comparison with the description of A. brevicornis, the type-species of the genus (recorded from Africa and Madagascar), and history of the known lymexylid larvae are also included.
Resumo:
The pathogenic fungus Fusarium graminearum is an ongoing threat to agriculture, causing losses in grain yield and quality in diverse crops. Substantial progress has been made in the identification of genes involved in the suppression of phytopathogens by antagonistic microorganisms; however, limited information regarding responses of plant pathogens to these biocontrol agents is available. Gene expression analysis was used to identify differentially expressed transcripts of the fungal plant pathogen F. graminearum under antagonistic effect of the bacterium Pantoea agglomerans. A macroarray was constructed, using 1014 transcripts from an F. graminearum cDNA library. Probes consisted of the cDNA of F. graminearum grown in the presence and in the absence of P. agglomerans. Twenty-nine genes were either up (19) or down (10) regulated during interaction with the antagonist bacterium. Genes encoding proteins associated with fungal defense and/or virulence or with nutritional and oxidative stress responses were induced. The repressed genes coded for a zinc finger protein associated with cell division, proteins containing cellular signaling domains, respiratory chain proteins, and chaperone-type proteins. These data give molecular and biochemical evidence of response of F. graminearum to an antagonist and could help develop effective biocontrol procedures for pathogenic plant fungi.
Resumo:
The objective of this study was to show the radial variation of some anatomic characteristics, wood density and natural durability of teak (Tectona grandis L.F.) growing in Costa Rica. Samples of trees 13 years old were obtained from two growing sites (high and low growing) of plantations established in a humid tropical climate (CHT) and dry tropical climate (CST). The variables measured of the fibers as well as for the rays were not affected by the climate or the type of growing site, except for the length of the fibers. The fibers of teak wood from the best growing site were significantly larger. Vessels were found with a greater frequency for the CST but mostly solitary in comparison with the CBT. Average density, maximum density and the variation within the ring presented a light higher magnitude for the CST. The quality of the growing site did not affect these variables. The resistance of fungus attack was similar in the area of heartwood near the pith compared to the heartwood near the sapwood for all the conditions evaluated. Nevertheless, it was observed in some trees a similar resistance of fungus attack for areas of sapwood compared to similar areas of heartwood.
Resumo:
The endophyte Guignardia mangiferae is closely related to G. citricarpa, the causal agent of citrus black spot; for many years these species had been confused with each other. The development of molecular analytical methods has allowed differentiation of the pathogen G. citricarpa from the endophyte G. mangiferae, but the physiological traits associated with pathogenicity were not described. We examined genetic and enzymatic characteristics of Guignardia spp strains; G. citricarpa produces significantly greater amounts of amylases, endoglucanases and pectinases, compared to G. mangiferae, suggesting that these enzymes could be key in the development of citrus black spot. Principal component analysis revealed pectinase production as the main enzymatic characteristic that distinguishes these Guignardia species. We quantified the activities of pectin lyase, pectin methylesterase and endopolygalacturonase; G. citricarpa and G. mangiferae were found to have significantly different pectin lyase and endopolygalacturonase activities. The pathogen G. citricarpa is more effective in pectin degradation. We concluded that there are significant physiological differences between the species G. citricarpa and G. mangiferae that could be associated with differences in pathogenicity for citrus plants.
Resumo:
Paracoccidioidomycosis is a mycotic disease caused by a dimorphic fungus, Paracoccidioides brasiliensis (Pb), that starts with inhalation of the fungus; thus, lung cells such as DC are part of the first line of defense against this microorganism. Migration of DC to the lymph nodes is the first step in initiating T cell responses. The mechanisms involved in resistance to Pb infection are poorly understood, but it is likely that DC play a pivotal role in the induction of effector T cells that control Pb infection. In this study, we showed that after Pb Infection, an important modification of lung DC receptor expression occurred. We observed an increased expression of CCR7 and CD103 on lung DC after infection, as well as MHC-II. After Pb infection, bone marrow-derived DC as well lung DC, migrate to lymph nodes. Migration of lung DC could represent an important mechanism of pathogenesis during PCM infection. In resume our data showed that Pb induced DC migration. Furthermore, we demonstrated that bone marrow-derived DC stimulated by Pb migrate to the lymph nodes and activate a T helper (Th) response. To the best of our knowledge, this is the first reported data showing that Pb induces migration of DC and activate a T helper (Th) response.
Resumo:
Aspergillus fumigatus is a common mould whose spores are a component of the normal airborne flora. Immune dysfunction permits developmental growth of inhaled spores in the human lung causing aspergillosis, a significant threat to human health in the form of allergic, and life-threatening invasive infections. The success of A. fumigatus as a pathogen is unique among close phylogenetic relatives and is poorly characterised at the molecular level. Recent genome sequencing of several Aspergillus species provides an exceptional opportunity to analyse fungal virulence attributes within a genomic and evolutionary context. To identify genes preferentially expressed during adaptation to the mammalian host niche, we generated multiple gene expression profiles from minute samplings of A. fumigatus germlings during initiation of murine infection. They reveal a highly co-ordinated A. fumigatus gene expression programme, governing metabolic and physiological adaptation, which allows the organism to prosper within the mammalian niche. As functions of phylogenetic conservation and genetic locus, 28% and 30%, respectively, of the A. fumigatus subtelomeric and lineage-specific gene repertoires are induced relative to laboratory culture, and physically clustered genes including loci directing pseurotin, gliotoxin and siderophore biosyntheses are a prominent feature. Locationally biased A. fumigatus gene expression is not prompted by in vitro iron limitation, acid, alkaline, anaerobic or oxidative stress. However, subtelomeric gene expression is favoured following ex vivo neutrophil exposure and in comparative analyses of richly and poorly nourished laboratory cultured germlings. We found remarkable concordance between the A. fumigatus host-adaptation transcriptome and those resulting from in vitro iron depletion, alkaline shift, nitrogen starvation and loss of the methyltransferase LaeA. This first transcriptional snapshot of a fungal genome during initiation of mammalian infection provides the global perspective required to direct much-needed diagnostic and therapeutic strategies and reveals genome organisation and subtelomeric diversity as potential driving forces in the evolution of pathogenicity in the genus Aspergillus.
Resumo:
The thermally dimorphic fungus Paracoccidioides brasiliensis (Pb) is the causative agent of paracoccidioidomycosis (PCM), one of the most frequent systemic mycosis that affects the rural population in Latin America. PCM is characterized by a chronic inflammatory granulomatous reaction, which is consequence of a Th1-mediated adaptive immune response. In the present study we investigated the mechanisms involved in the immunoregulation triggered after a prior contact with cell-free antigens (CFA) during a murine model of PCM. The results showed that the inoculation of CFA prior to the infection resulted in disorganized granulomatous lesions and increased fungal replication in the lungs, liver and spleen, that paralleled with the higher levels of IL-4 when compared with the control group. The role of IL-4 in facilitating the fungal growth was demonstrated in IL-4-deficient- and neutralizing anti-IL-4 mAb-treated mice. The injection of CFA did not affect the fungal growth in these mice, which, in fact, exhibited a significant diminished amount of fungus in the tissues and smaller granulomas. Considering that in vivo anti-IL-4-application started one week after the CFA-inoculum, it implicates that IL-4-CFA-induced is responsible by the mediation of the observed unresponsiveness. Further, the characterization of CFA indicated that a proteic fraction is required for triggering the immunosuppressive mechanisms, while glycosylation or glycosphingolipids moieties are not. Taken together, our data suggest that the prior contact with soluble Pb antigens leads to severe PCM in an IL-4 dependent manner.
Resumo:
Background: Cutaneous mycoses are common human infections among healthy and immunocompromised hosts, and the anthropophilic fungus Trichophyton rubrum is the most prevalent microorganism isolated from such clinical cases worldwide. The aim of this study was to determine the transcriptional profile of T. rubrum exposed to various stimuli in order to obtain insights into the responses of this pathogen to different environmental challenges. Therefore, we generated an expressed sequence tag (EST) collection by constructing one cDNA library and nine suppression subtractive hybridization libraries. Results: The 1388 unigenes identified in this study were functionally classified based on the Munich Information Center for Protein Sequences (MIPS) categories. The identified proteins were involved in transcriptional regulation, cellular defense and stress, protein degradation, signaling, transport, and secretion, among other functions. Analysis of these unigenes revealed 575 T. rubrum sequences that had not been previously deposited in public databases. Conclusion: In this study, we identified novel T. rubrum genes that will be useful for ORF prediction in genome sequencing and facilitating functional genome analysis. Annotation of these expressed genes revealed metabolic adaptations of T. rubrum to carbon sources, ambient pH shifts, and various antifungal drugs used in medical practice. Furthermore, challenging T. rubrum with cytotoxic drugs and ambient pH shifts extended our understanding of the molecular events possibly involved in the infectious process and resistance to antifungal drugs.
Resumo:
Aspergillus niveus produced high levels of alpha-amylase and glucoamylase in submerged fermentation using the agricultural residue cassava peel as a carbon source. In static conditions, the amylase production was substantially greater than in the agitated condition. The optimized culture conditions were initially at pH 5.0, 35 degrees C during 48 hours. Amylolytic activity was still improved (50%) with a mixture of cassava peel and soluble starch in the proportion 1:1 (w/w). The crude extract exhibited temperature and pH optima approximately 70 degrees C and 4.5, respectively. Amylase activity was stable for 1 h at 60 degrees C, and at pH values between 3.0 and 7.0. The enzyme hydrolysed preferentially maltose, starch, penetrose, amylose, isomaltose, maltotriose, glycogen and amylopectin, and not hydrolysed cyclodextrin (alpha and beta), trehalose and sucrose. In the first hour of reaction on soluble starch, the hydrolysis products were glucose and maltose, but after two hours of hydrolysis, glucose was the unique product formed, confirming the presence in the crude extract of an alpha-amylase and a glucoamylase.
Resumo:
Pathogenicity of strains of the entomopathogenic fungus Beauveria bassiana and endophytic strains of Beauveria sp against the bovine tick Rhipicephalus (Boophilus) microplus was tested in laboratory bioassays and under field conditions. Suspensions containing 10(5), 10(7) and 10(9) conidia/mL were prepared of each fungal strain for laboratory bioassays. The ticks were maintained at 28 degrees C, 90 +/- 5% relative humidity, and the following variables were evaluated: initial female weight, egg weight, hatching percentage, reproductive efficiency, and percentage control. For tests under field conditions, a Beauveria suspension containing 10(6) conidia/mL was sprayed on tick-infested cows. After 72 h, the ticks were collected to estimate mortality under field conditions. Laboratory bioassays showed a mortality of 20 to 50% of the ticks seven days after inoculation with 10(7) Beauveria conidia/mL. Under field conditions 10(6) Beauveria conidia/mL induced 18-32% mortality. All Beauveria strains were effective in biological control of R. (Boophilus) microplus under laboratory and field test conditions. This is the first demonstration that endophytic fungi can be used for biological control of the cattle tick; this could help reduce environmental contamination by diminishing the need for chemical acaricides. Two endophytic strains were isolated from maize leaves and characterized by molecular sequencing of 5.8S rDNA ITS1 and ITS2 and morphological analyses of conidia. We found that these two endophytic Beauveria isolates, designated B95 and B157, are close to Beauveria amorpha.