Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Tratamento da retinopatia diabética: percepções de pacientes em Rio Claro (SP) - Brasil

PURPOSE: To collect information and opinions from a group of diabetic patients regarding diabetic retinopathy and its treatment, in order to get reliable information that can help to improve programs and actions to control and prevent this ocular disease. METHODS: A cross-sectional study was performed. The sample was from 980 diabetic patients seen in a diabetic association. A previous questionnaire was made with general questions about the main subject. Thereafter, an appropriate questionnaire was prepared. RESULTS: The sample showed that among 299 patients with age ranging from 16 to 83 years, with a mean of 57 years, mainly female (67.91%) did not know how severe their disease was (30.8%), or believed that it was not a serious problem (19.7%). The laser technique to solve diabetic retinopathy was known by 60.2% of the patients. It was reported as the only treatment available by 24.1%. Among the reasons for no treatment 59.8% reported that they did not think it was necessary and 29.7% could not afford it. CONCLUSIONS: Patients showed lack of knowledge about how serious is diabetic retinopathy, the possibility of using laser technique for it and the severity of the disease. Some patients believed in the efficacy of the treatment and some patients did not, but all of them reported that they were afraid of submitting to it.

As conferências nacionais do esporte na configuração da política esportiva e de lazer no governo Lula (2003-2010)

Universidade Estadual de Campinas . Faculdade de Educação Física

Centros de treinamento de ginástica rítmica no Brasil : estrutura e programas

Universidade Estadual de Campinas . Faculdade de Educação Física

Acompanhamento de indicadores de crescimento físico, maturação biológica, qualidade óssea e desempenho motor, em jovens praticantes de atletismo

Universidade Estadual de Campinas . Faculdade de Educação Física

O esporte paraolímpico no Brasil : abordagem da sociologia do esporte de Pierre Bourdieu

Universidade Estadual de Campinas . Faculdade de Educação Física

Realidade da olimpíada colegial do estado de São Paulo (OCESP) em relação ao discurso presente na educação física acerca da competição escolar : estudo da região leste de Campinas

Universidade Estadual de Campinas . Faculdade de Educação Física

Esporte e clube sócio-esportivo : percurso, contextos e perspectivas a partir de um estudo de caso em clube esportivo espanhol

Universidade Estadual de Campinas . Faculdade de Educação Física

Significados do taiko no Instituto Cultural Nipo Brasileiro de Campinas

Universidade Estadual de Campinas . Faculdade de Educação Física

O rugbi em cadeira de rodas : aspectos tecnicos e taticos e diretrizes para seu desenvolvimento

Universidade Estadual de Campinas . Faculdade de Educação Física

O programa de erradicação do trabalho infantil e suas praticas corporais : o caso de Sumare

Universidade Estadual de Campinas. Faculdade de Educação Física

Analise da descontinuidade do patrocinio esportivo em clubes de futebol no Brasil

Universidade Estadual de Campinas . Faculdade de Educação Física

As contribuições de Seymour Fisher para os estudos em imagem corporal

Universidade Estadual de Campinas . Faculdade de Educação Física

Associativismo, lazer e esporte nos clubes sociais de Campinas

Universidade Estadual de Campinas . Faculdade de Educação Física

A influencia do esporte espetaculo sobre o modelo de competição dos mais jovens no judo

Universidade Estadual de Campinas . Faculdade de Educação Física