Applicability of an assessment model for healthcare information systems in a public hospital

Assessment processes are essential to guarantee quality and continuous improvement of software in healthcare, as they measure software attributes in their lifecycle, verify the degree of alignment between the software and its objectives and identify unpredicted events. This article analyses the use of an assessment model based on software metrics for three healthcare information systems from a public hospital that provides secondary and tertiary care in the region of Ribeirão Preto. Compliance with the metrics was investigated using questionnaires in guided interviews of the system analysts responsible for the applications. The outcomes indicate that most of the procedures specified in the model can be adopted to assess the systems that serves the organization, particularly in the attributes of compatibility, reliability, safety, portability and usability.

[access To Information About How To Prevent Oral Problems Among School Children In The Public School Network].

The scope of this study is to identify the prevalence of access to information about how to prevent oral problems among schoolchildren in the public school network, as well as the factors associated with such access. This is a cross-sectional and analytical study conducted among 12-year-old schoolchildren in a Brazilian municipality with a large population. The examinations were performed by 24 trained dentists and calibrated with the aid of 24 recorders. Data collection occurred in 36 public schools selected from the 89 public schools of the city. Descriptive, univariate and multiple analyses were conducted. Of the 2510 schoolchildren included in the study, 2211 reported having received information about how to prevent oral problems. Access to such information was greater among those who used private dental services; and lower among those who used the service for treatment, who evaluated the service as regular or bad/awful. The latter use toothbrush only or toothbrush and tongue scrubbing as a means of oral hygiene and who reported not being satisfied with the appearance of their teeth. The conclusion drawn is that the majority of schoolchildren had access to information about how to prevent oral problems, though access was associated with the characteristics of health services, health behavior and outcomes.

Burnout Syndrome In Nursing Assistants Of A Public Hospital In The State Of São Paulo.

The burnout syndrome is a psychosocial phenomenon that arises as a response to chronic interpersonal stressors present at work. There are many aspects that make nursing assistants vulnerable to chronic stress situations that may lead to burnout, highlighting the low degree of autonomy in the healthcare staff and spending more in direct contact with patients. To assess the prevalence of the burnout syndrome in nursing assistants in a public hospital, as well as its association with socio-demographic and professional variables. A socio-demographic and professional questionnaire and the Maslach Burnout Inventory (MBI-SS) were applied to 534 nursing assistants. The prevalence of burnout syndrome among nursing assistants was 5.9%. High emotional exhaustion was observed in 23.6%, 21.9% showed high depersonalization, and 29.9% low professional achievement. It was found statistically significant associations between emotional exhaustion, job sector and marital status; depersonalization, having children and health problems; low professional achievement and job sector and number of jobs. There was association between job satisfaction and the three dimensions. Professionals working in the health area must pay intense and extended attention to people who are dependent upon others. The intimate contact of the nursing assistants with hard-to-handle patients, as well as being afraid to make mistakes in healthcare are additional chronic stress factors and burnout syndrome cases related in this study.

[need For Orthodontic Treatment Among Brazilian Adolescents: Evaluation Based On Public Health].

To identify the prevalence and the severity of malocclusions and to analyze factors associated with the need for orthodontic treatment of Brazilian adolescents. This exploratory, cross-sectional study was carried out based on secondary data from the national epidemiological survey on oral health in Brazil (2002-2003). Socio-demographic conditions, self-perception, and the existence and degree of malocclusion, using the Dental Aesthetic Index, were evaluated in 16,833 adolescent Brazilians selected by probabilistic sample by conglomerates. The dependent variable - need orthodontic treatment - was estimated from the severity of malocclusion. The magnitude and direction of the association in bivariate and multivariate analyzes from a Robust Poisson regression was estimated RESULTS: The majority of the adolescents needed orthodontic treatment (53.2%). In the multivariate analysis, the prevalence of the need for orthodontic treatment was larger among females, non-whites, those that perceived a need for treatment, and those that perceived their appearance as normal, bad, or very bad. The need for orthodontic treatment was smaller among those that lived in the Northeast and Central West macro-regions compared to those living in Southeast Brazil and it was also smaller among those that perceived their chewing to be normal or their oral health to be bad or very bad. There was a high prevalence of orthodontic treatment need among adolescents in Brazil and this need was associated with demographic and subjective issues. The high prevalence of orthodontic needs in adolescents is a challenge to the goals of Brazil's universal public health system.

In Adolescents With Epilepsy, High Scores Of Anxiety And Depression Are Associated With Occurrence Of Seizures In Public Places.

Objective To assess depression and anxiety symptoms of adolescents with epilepsy compared with adolescents without epilepsy. Method The study sample consisted of: case participants (50 subjects) attending the pediatric epilepsy clinic of a tertiary hospital and control participants (51 subjects) from public schools. The instruments utilized were: identification card with demographic and epilepsy data, Beck Depression Inventory and State-Trait Anxiety Inventory. Results No significant differences were founded between the groups regarding scores for depression and anxiety symptoms but both groups presented moderate scores of anxiety. A correlation was found between low scores anxiety and not frequent seizures, low scores anxiety and perception of seizure control, high scores of anxiety and depression and occurrence of seizures in public places. Conclusion Low scores of anxiety are associated with not frequent seizures; high scores of anxiety and depression are associated with occurrence of seizures in public places.

Indications For In Vitro Fertilization At A Public Center For Reproductive Health In Campinas, Brazil.

To assess the sociodemographic profile and gynecologic and obstetric characteristics of women referred to a public reference center in Campinas, Brazil, for in vitro fertilization (IVF). Women referred between April 1, 2008, and October 31, 2009, were eligible for inclusion in a cross-sectional study. Participants were interviewed about sociodemographic characteristics, obstetric and gynecologic history, and etiologic factors resulting in the referral. Preliminary clinical examinations performed elsewhere were evaluated. A total of 176 women were included, of whom 129 (73.3%) presented with tubal factor infertility. Tubal ligation had been performed in 66 (37.5%) women. Overall, 121 (68.8%) women were aged 30 years old or less, 110 (62.5%) had received more than 8 years of schooling, 123 (69.6%) had had infertility for up to 5 years, and 99 (56.3%) did not have any children. Moreover, 25 (14.2%) women had endometriosis and 25 (14.2%) had a male factor issue. A previous ectopic pregnancy was reported for 20 (11.4%) women and pelvic inflammatory disease for 49 (27.8%). Tubal factor infertility was the most common indication for IVF. Preventive measures are required, in addition to policies that ensure access to high-complexity treatments in the public sector.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Comparative analysis of adverse events between infliximab and adalimumab in Crohn's disease management: a Brazilian single-centre experience

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.

As conferências nacionais do esporte na configuração da política esportiva e de lazer no governo Lula (2003-2010)

Universidade Estadual de Campinas . Faculdade de Educação Física

Realidade da olimpíada colegial do estado de São Paulo (OCESP) em relação ao discurso presente na educação física acerca da competição escolar : estudo da região leste de Campinas

Universidade Estadual de Campinas . Faculdade de Educação Física

Barreiras socio-culturais e lazer das pessoas portadoras de deficiencia fisica : um estudo do grupo Fraternidade Cristã de Doença e Deficiencia de Campinas, SP

Universidade Estadual de Campinas. Faculdade de Educação Física

A ginastica geral na sociedade contemporanea : pespectivas para a Educação Fisica escolar

Universidade Estadual de Campinas. Faculdade de Educação Física

O setor privado sem fins lucrativos e as políticas públicas de esporte e lazer (2008-2011) = : The non-profitable private sector and the public policies for sport and leisure (2008-2011)

Universidade Estadual de Campinas . Faculdade de Educação Física

Effects of a novel calcium aluminate cement on the early events of the progression of osteogenic cell cultures

The present study evaluated the progression of osteogenic cell cultures exposed to a novel calcium aluminate cement (CAC+) in comparison with the gold standard mineral trioxide aggregate (MTA). Cells were enzimatically isolated from newborn rat calvarial bone, plated on glass coverslips containing either CAC+ or a control MTA samples in the center, and grown under standard osteogenic conditions. Over the 10-day culture period, roundening of sample edges was clearly noticed only for MTA group. Although both cements supported osteogenic cell adhesion, spreading, and proliferation, CAC+-exposed cultures showed significantly higher values in terms of total cell number at days 3 and 7, and total protein content and alkaline phosphatase activity at day 10. The present in vitro results indicate that the exposure to CAC+ supports a higher differentiation of osteogenic cells compared with the ones exposed to MTA. Further experimental studies should consider CAC+ as a potential alternative to MTA when the repair of mineralized tissues is one of the desired outcomes in endodontic therapy.

Oral Health in Brazil - Part I: public oral health policies

This paper reviews the historical development of public health policies in Brazil and the insertion of oral health in this context. Since 1988, Brazil established a Unified National Health System ("Sistema Único de Saúde" - SUS), which was conceived to assure access to health actions and services, including oral health. However, a history of lack of access to health services and the health problems faced by the Brazilian population make the process of building and consolidating the SUS extremely challenging. Since 2004, the Oral Health National Policy has proposed a reorientation of the health care model, supported by an adaptation of the working system of Oral Health teams so that they include actions of health promotion, protection and recovery. Human resources should be prepared to act in this system. The qualifying process must take in consideration knowledge evolution, changes in the work process and changes in demographical and epidemiological aspects, according to a perspective of maintaining a balance between technique and social relevance.