988 resultados para native fruit tree
Resumo:
Besides their own adaptation strategies, plants might exploit microbial symbionts for overcoming both biotic and abiotic stresses and increase fitness. The current scenario of rapid climate change is demanding more sustainable agricultural management practices. The application of microbe-based products as a valid alternative to synthetic pesticides and fertilizers and their use to overcome stresses exacerbated by climate change, have been reviewed in the first part of this thesis. Berry fruits are widely cultivated and appreciated for their aromatic and nutraceutical properties. This thesis is focused on the role of plant and fruit microbiome on strawberry and raspberry growth, resistance, fruit quality and aroma. A taxonomical and functional description of the microbiome of different organs of three strawberry genotypes was performed both by traditional cultural dependent method and Next Generation Sequencing technique, highlighting a significant role of plant organs and genotype in determining the composition of microbial communities. Additionally, a selection of bacteria native of strawberry plants were isolated and screened for their plant growth promoting abilities and tested under the biotic stress of Xanthomonas fragariae infection and the abiotic stress of induced salinity. The monitoring of biometric parameters allowed the selection of a more restricted panel of bacterial strains, whose beneficial potential was tested in coordinated inoculations, or singularly. Raspberry plant was used for investigating the effect of cultivation method in determining fruit microbiome, and its consequent influence of berry quality and aroma. Interestingly, the cultivation method strongly influenced fruit nutraceutical traits, aroma and epiphytic bacterial biocoenosis. The involvement of the bacterial microbiota in fruit aroma determination was evaluated by performing GC–MS analysis of VOCs occurring in control, sterile and artificially reinoculated berries and by characterizing control and reinoculated berry microbiome. Differently treated berries showed significantly different aromatic profile, confirming the role of bacteria in fruit aroma development.
Resumo:
Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein.
Resumo:
Genipap fruits, native to the Amazon region, were classified in relation to their stage of ripeness according to firmness and peel color. The influence of the part of the genipap fruit and ripeness stage on the iridoid and phenolic compound profiles was evaluated by HPLC-DAD-MS(n), and a total of 17 compounds were identified. Geniposide was the major compound in both parts of the unripe genipap fruits, representing >70% of the total iridoids, whereas 5-caffeoylquinic acid was the major phenolic compound. In ripe fruits, genipin gentiobioside was the major compound in the endocarp (38%) and no phenolic compounds were detected. During ripening, the total iridoid content decreased by >90%, which could explain the absence of blue pigment formation in the ripe fruits after their injury. This is the first time that the phenolic compound composition and iridoid contents of genipap fruits have been reported in the literature.
Resumo:
Essential oils (EO) obtained from twenty medicinal and aromatic plants were evaluated for their antimicrobial activity against the oral pathogens Candida albicans, Fusobacterium nucleatum, Porphyromonas gingivalis, Streptococcus sanguis and Streptococcus mitis. The antimicrobial activity of the EO was evaluates by microdilution method determining Minimal Inhibitory Concentration. Chemical analysis of the oils compounds was performed by Gas chromatography-mass spectrometry (CG-MS). The most active EO were also investigated as to their actions on the biolfilm formation. The most of the essential oils (EO) presented moderate to strong antimicrobial activity against the oral pathogens (MIC--Minimal Inhibitory Concentrations values between 0.007 and 1.00 mg/mL). The essential oil from Coriandrum sativum inhibited all oral species with MIC values from 0.007 to 0.250 mg/mL, and MBC/MFC (Minimal Bactericidal/Fungicidal Concentrations) from 0.015 to 0.500 mg/mL. On the other hand the essential oil of C. articulatus inhibited 63.96% of S. sanguis biofilm formation. Through Scanning Eletronic Microscopy (SEM) images no changes were observed in cell morphology, despite a decrease in biofilm formation and changes on biofilm structure. Chemical analysis by Gas Chromatography-Mass Spectrometry (GC-MS) of the C. sativum essential oil revealed major compounds derivatives from alcohols and aldehydes, while Cyperus articulatus and Aloysia gratissima (EOs) presented mono and sesquiterpenes. In conclusion, the crude oil from C. articulatus exhibited the best results of antimicrobial activity e ability to control biofilm formation. The chemical analysis showed the presence of terpenes and monoterpenes such as a-pinene, a-bulnesene and copaene. The reduction of biofilms formation was confirmed from SEM images. The results of this research shows a great potential from the plants studied as new antimicrobial sources.
Resumo:
Passiflora species are distributed throughout Latin America, and Brazil and Colombia serve as the centers of diversity for this genus. We performed cross-species amplification to evaluate 109 microsatellite loci in 14 Passiflora species and estimated the diversity and genetic structure of Passiflora cincinnata, Passiflora setaceae and Passiflora edulis. A total of 127 accessions, including 85 accessions of P. edulis, a commercial species, and 42 accessions of 13 wild species, were examined. The cross-species amplification was effective for obtaining microsatellite loci (average cross-amplification of 70%). The average number of alleles per locus (five) was relatively low, and the average diversity ranged from 0.52 in P. cincinnata to 0.32 in P. setacea. The Bayesian analyses indicated that the P. cincinnata and P. setacea accessions were distributed into two groups, and the P. edulis accessions were distributed into five groups. Private alleles were identified, and suggestions for core collections are presented. Further collections are necessary, and the information generated may be useful for breeding and conservation.
Resumo:
• Microsatellite primers were designed for Piptadenia gonoacantha (Fabaceae) and characterized to estimate genetic diversity parameters. The species is a native tree from the Atlantic Forest biome commonly used in forest restoration; it has medicinal potential and the wood is economically useful. • Twenty-eight microsatellite loci were identified from an enriched genomic library. Fifteen loci resulted in successful amplifications and were characterized in a natural population of 94 individuals. Twelve loci were polymorphic, with allele numbers ranging from three to 15 per locus, and expected and observed heterozygosities ranging from 0.2142 to 0.8325 and 0.190 to 0.769, respectively. • The developed markers will be used in further studies of population genetics of P. gonoacantha, aimed at conservation and management of the species in natural populations and in forest restoration projects.
Resumo:
Trees from tropical montane cloud forest (TMCF) display very dynamic patterns of water use. They are capable of downwards water transport towards the soil during leaf-wetting events, likely a consequence of foliar water uptake (FWU), as well as high rates of night-time transpiration (Enight) during drier nights. These two processes might represent important sources of water losses and gains to the plant, but little is known about the environmental factors controlling these water fluxes. We evaluated how contrasting atmospheric and soil water conditions control diurnal, nocturnal and seasonal dynamics of sap flow in Drimys brasiliensis (Miers), a common Neotropical cloud forest species. We monitored the seasonal variation of soil water content, micrometeorological conditions and sap flow of D. brasiliensis trees in the field during wet and dry seasons. We also conducted a greenhouse experiment exposing D. brasiliensis saplings under contrasting soil water conditions to deuterium-labelled fog water. We found that during the night D. brasiliensis possesses heightened stomatal sensitivity to soil drought and vapour pressure deficit, which reduces night-time water loss. Leaf-wetting events had a strong suppressive effect on tree transpiration (E). Foliar water uptake increased in magnitude with drier soil and during longer leaf-wetting events. The difference between diurnal and nocturnal stomatal behaviour in D. brasiliensis could be attributed to an optimization of carbon gain when leaves are dry, as well as minimization of nocturnal water loss. The leaf-wetting events on the other hand seem important to D. brasiliensis water balance, especially during soil droughts, both by suppressing tree transpiration (E) and as a small additional water supply through FWU. Our results suggest that decreases in leaf-wetting events in TMCF might increase D. brasiliensis water loss and decrease its water gains, which could compromise its ecophysiological performance and survival during dry periods.
Resumo:
In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.
Resumo:
Approximately 7.2% of the Atlantic rainforest remains in Brazil, with only 16% of this forest remaining in the State of Rio de Janeiro, all of it distributed in fragments. This forest fragmentation can produce biotic and abiotic differences between edges and the fragment interior. In this study, we compared the structure and richness of tree communities in three habitats - an anthropogenic edge (AE), a natural edge (NE) and the fragment interior (FI) - of a fragment of Atlantic forest in the State of Rio de Janeiro, Brazil (22°50'S and 42°28'W). One thousand and seventy-six trees with a diameter at breast height > 4.8 cm, belonging to 132 morphospecies and 39 families, were sampled in a total study area of 0.75 ha. NE had the greatest basal area and the trees in this habitat had the greatest diameter:height allometric coefficient, whereas AE had a lower richness and greater variation in the height of the first tree branch. Tree density, diameter, height and the proportion of standing dead trees did not differ among the habitats. There was marked heterogeneity among replicates within each habitat. These results indicate that the forest interior and the fragment edges (natural or anthropogenic) do not differ markedly considering the studied parameters. Other factors, such as the age from the edge, type of matrix and proximity of gaps, may play a more important role in plant community structure than the proximity from edges.
Resumo:
The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.
Resumo:
The aim of this work was to evaluate the floristic composition, richness, and diversity of the upper and lower strata of a stretch of mixed rain forest near the city of Itaberá, in southeastern Brazil. We also investigated the differences between this conservation area and other stretches of mixed rain forest in southern and southeastern Brazil, as well as other nearby forest formations, in terms of their floristic relationships. For our survey of the upper stratum (diameter at breast height [DBH] > 15 cm), we established 50 permanent plots of 10 × 20 m. Within each of those plots, we designated five, randomly located, 1 × 1 m subplots, in order to survey the lower stratum (total height > 30 cm and DBH < 15 cm). In the upper stratum, we sampled 1429 trees and shrubs, belonging to 134 species, 93 genera, and 47 families. In the lower stratum, we sampled 758 trees and shrubs, belonging to 93 species, 66 genera, and 39 families. In our floristic and phytosociological surveys, we recorded 177 species, belonging to 106 genera and 52 families. The Shannon Diversity Index was 4.12 and 3.5 for the upper and lower strata, respectively. Cluster analysis indicated that nearby forest formations had the strongest floristic influence on the study area, which was therefore distinct from other mixed rain forests in southern Brazil and in the Serra da Mantiqueira mountain range.
Resumo:
Mistletoe can have a major impact on the fitness of the host plant. If there is more than one species of mistletoe on the same host tree, the overall impact might be amplified. We report the occurrence of more than one species of mistletoe on the same host tree. Although it is not a rule in the field, to our knowledge, there have been no studies of this topic. In most cases, two species of mistletoe were recorded on the same host tree, although we recorded three species of mistletoe on one occasion. This demonstrates that different species of mistletoe can be compatible with the same host species. Therefore, compatibility (structural and physiological) might be an important factor for the occurrence of mistletoe. Recent studies have shown that if the mistletoe does not recognize the host species, the deposited seeds will germinate but the haustorium will not penetrate the host branch. This is probably the primary mechanism in the establishment of more than one species of mistletoe on the same host, which can trigger a cascade of harmful effects for the host species.
Resumo:
The objective of the work was to evaluate the effects of environment, recipients, and substrate compositions in passion fruit (Passiflora edulis Sims f. flavicarpa Deg.) seedlings biomass production in Pantanal region from September to November of 2006. Experimental trials were conducted in four protected environments, in two types of containers and three different substrate compositions. The environments were: A1 (greenhouse covered with low-density, 150-microns-thick polyethylene film), A2 (monofilament black screened with mesh for 50% of shade), A3 (aluminized screened with mesh for 50% of shade) and A4 (environment covered with straw of native coconut palm); the recipients were: polyethylene bags (R1) (15 x 25 cm) and polystyrene trays (R2) (with 72 cells). There substrates were: S1 (soil + organic compost + vermiculite, 1:1: 1 v/v), S2 (soil + organic compost + sawdust, 1:1: 1 v/v) and S3 (soil + organic compost + vermiculite + sawdust, 1:1: 1/2: 1/2 v/v). The experimental design was completely randomized statistical analysis in split-split-plot, with fifteen replications. The treatments in the plot were environments, in the subplots were pots, and subsubplots were substrates (4 x 2 x 3 = 24 treatments). Fresh and dry mass of aerial and root system parts were evaluated. Environments with screen showed better results for seedlings of yellow passion fruit biomass in polyethylene bags. Polyethylene bags promoted higher biomasses. The substrate with vermiculite showed better results for both types of containers. The substrate with a higher percentage of sawdust showed the worst result.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Yellow passion fruit pulp is unstable, presenting phase separation that can be avoided by the addition of hydrocolloids. For this purpose, xanthan and guar gum [0.3, 0.7 and 1.0% (w/w)] were added to yellow passion fruit pulp and the changes in the dynamic and steady - shear rheological behavior evaluated. Xanthan dispersions showed a more pronounced pseudoplasticity and the presence of yield stress, which was not observed in the guar gum dispersions. Cross model fitting to flow curves showed that the xanthan suspensions also had higher zero shear viscosity than the guar suspensions, and, for both gums, an increase in temperature led to lower values for this parameter. The gums showed different behavior as a function of temperature in the range of 5 - 35ºC. The activation energy of the apparent viscosity was dependent on the shear rate and gum concentration for guar, whereas for xanthan these values only varied with the concentration. The mechanical spectra were well described by the generalized Maxwell model and the xanthan dispersions showed a more elastic character than the guar dispersions, with higher values for the relaxation time. Xanthan was characterized as a weak gel, while guar presented a concentrated solution behavior. The simultaneous evaluation of temperature and concentration showed a stronger influence of the polysaccharide concentration on the apparent viscosity and the G' and G" moduli than the variation in temperature.