927 resultados para mRNA export


Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper studies the role of Vertical Specialization-based trade and foreign damand push as elements capable of explaining export-led recoveries in small open industrialized economies. The empirical evidence on export-led recoveries is reviewed. Data supporting the growing importance of vertical specialization for international trade are presented. I compare the performance of two versions of a small open economy model, calibrated to mimic Canadian Business Cycles. The …rst one is based upon Schmitt-Grohe(1998). The second incorporates Vertical- Specialization-based trade. I show that an arti…cial economy featuring Vertical-Specializationbased trade in conjunction with an exogenous AR(2) process for foreign output displays improved impulse responses to a foreign output shock and is able to mimic the contribution of Canadian exports to output growth during economic recoveries.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This descriptive paper examines the prevalence of ‘WTO-plus’ commitments in accession protocols of newly acceded Members, with a focus on commitments on the elimination of export duties. It presents preliminary results of a mapping exercise carried out with respect to these commitments and seeks to answer two questions. First, can any general conclusions be drawn as to the prevalence of these commitments or are they, per definition, country-specific. Second, has the political nature of the WTO accession process allowed for the creation of a two-tier membership. The first question is answered by relying on data gathered as part of the ongoing PhD-research project conducted by the author. The project aims to construct a typology of WTO-plus commitments to allow for a more detailed analysis of the relationship between these commitments and the baseline obligations in the covered agreements. The accession of China to the WTO is commonly considered as the prime example of the inclusion of WTO-plus obligations in accession protocols. The paper tries to answer the question whether this particular accession was truly unique in nature, or whether the inclusion of “Plus” obligations is less exceptional than often assumed. Additionally, the accession protocols of other recently acceded-Members are examined to establish whether the hypothesis holds. In the PhD-research project this comparative methodology will also be applied to map WTO-plus commitments in other areas, such as anti-dumping and transparency. The second question will be answered in two stages. In a preliminary stage, international institutional law will be used to by analyzing the way in which the WTO’s Dispute Settlement Body has dealt with this type of WTO-plus commitment in its jurisprudence. The second stage deals with the question of hierarchy: Accession Protocols are negotiated with the WTO Membership, by each country willing to accede to the WTO. This poses questions as to their exact position in the system of WTO law. To establish whether evidence of a two-tier membership is present, one first has to turn back to the question whether Accession Protocols are a separate (or independent) legal instrument or an “integral part” of the WTO system of covered agreements. If newly acceded Members do not benefit from the general exceptions in order to balance their more stringent, WTO-plus, obligations, this may support the conclusion that the membership of the World Trade Organization is becoming, in fact, two-tiered.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to investigate the hormonal regulation of the avian homolog of mammalian uncoupling protein (avUCP) by studying the impact of thyroid hormones and insulin on avUCP mRNA expression in chickens (Gallus gallus). For 3 wk, chicks received either a standard diet (control group), or a standard diet supplemented with triiodothyronine (T-3; T3 group) or with the thyroid gland inhibitor methimazole (MMI group). A fourth group received injections of the deiodinase inhibitor iopanoic acid (IOP group). During the 4th wk of age, all animals received two daily injections of either human insulin or saline solution. The results indicate a twofold overexpression of avUCP mRNA in gastrocnemius muscle of T3 birds and a clear downregulation (-74%) in MMI chickens compared with control chickens. Insulin injections had no significant effect on avUCP mRNA expression in chickens. This study describes for the first time induction of avUCP mRNA expression by the thermogenic hormone T3 in chickens and supports a possible involvement of avUCP in avian thermogenesis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The human ZC3H14 gene encodes an evolutionarily conserved Cys(3)His zinc finger protein that binds specifically to polyadenosine RNA and is thus postulated to modulate post-transcriptional gene expression. Expressed sequence tag (EST) data predicts multiple splice variants of both human and mouse ZC3H14. Analysis of ZC3H14 expression in both human cell lines and mouse tissues confirms the presence of multiple alternatively spliced transcripts. Although all of these transcripts encode protein isoforms that contain the conserved C-terminal zinc finger domain, suggesting that they could all bind to polyadenosine RNA, they differ in other functionally important domains. Most of the alternative transcripts encode closely related proteins (termed isoforms 1, 2. 3, and 3short) that differ primarily in the inclusion of three small exons, 9, 10, and 11, resulting in predicted protein isoforms ranging from 82 to 64 kDa. Each of these closely related isoforms contains predicted classical nuclear localization signals (cNLS) within exons 7 and 11. Consistent with the presence of these putative nuclear targeting signals, these ZC3H14 isoforms are all localized to the nucleus. In contrast, an additional transcript encodes a smaller protein (34 kDa) with an alternative first exon (isoform, 4). Consistent with the absence of the predicted cNLS motifs located in exons 7 and 11, ZC3H14 isoform 4 is localized to the cytoplasm. Both EST data and experimental data suggest that this variant is enriched in testes and brain. Using an antibody that detects endogenous ZC3H14 isoforms 1-3 reveals localization of these isoforms to nuclear speckles. These speckles co-localize with the splicing factor, SC35, suggesting a role for nuclear ZC3H14 in mRNA processing. Taken together, these results demonstrate that multiple transcripts encoding several ZC3H14 isoforms exist in vivo. Both nuclear and cytoplasmic ZC3H14 isoforms could have distinct effects on gene expression mediated by the common Cys(3)His zinc finger polyadenosine RNA binding domain. (C) 2009 Elsevier B.V. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The putative translation factor eIF5A is essential for cell viability and is highly conserved from archaebacteria to mammals. This factor is the only cellular protein that undergoes an essential posttranslational modification dependent on the polyamine spermidine, called hypusination. This review focuses on the functional characterization of eIF5A. Although this protein was originally identified as a translation initiation factor, subsequent studies did not support a role for eIF5A in general translation initiation. eIF5A has also been implicated in nuclear export of HIV-1 Rev and mRNA decay, but these findings are controversial in the literature and may reflect secondary effects of eIF-5A function. Next, the involvement of eIF5A and hypusination in the control of the cell cycle and proliferation in various organisms is reviewed. Finally, recent evidence in favor of reconsidering the role of eIF5A as a translation factor is discussed. Future studies may reveal the specific mechanism by which eIF5A affects protein synthesis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Augmented glucose-stimulated insulin secretion (GSIS) is an adaptive mechanism exhibited by pancreatic islets from insulin-resistant animal models. Gap junction proteins have been proposed to contribute to islet function. As such, we investigated the expression of connexin 36 (Cx36), connexin 43 (Cx43), and the glucose transporter Glut2 at mRNA and protein levels in pancreatic islets of dexamethasone (DEX)-induced insulin-resistant rats. Study rats received daily injections of DEX (1 mg/kg body mass, i.p.) for 5 days, whereas control rats (CTL) received saline solution. DEX rats exhibited peripheral insulin resistance, as indicated by the significant postabsorptive insulin levels and by the constant rate for glucose disappearance (K-ITT). GSIS was significantly higher in DEX islets (1.8-fold in 16.7 mmol/L glucose vs. CTL, p < 0.05). A significant increase of 2.25-fold in islet area was observed in DEX vs. CTL islets (p < 0.05). Cx36 mRNA expression was significantly augmented, Cx43 diminished, and Glut2 mRNA was unaltered in islets of DEX vs. CTL (p < 0.05). Cx36 protein expression was 1.6-fold higher than that of CTL islets (p < 0.05). Glut2 protein expression was unaltered and Cx43 was not detected at the protein level. We conclude that DEX-induced insulin resistance is accompanied by increased GSIS and this may be associated with increase of Cx36 protein expression.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)