992 resultados para Sugar cane - Biological control


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The objective was to evaluate the genetic diversity of cultivars in sugar cane for resistance to D. saccharalis. The experiment was carried out in the laboratory in completely randomized design with 11 treatments (one control and 10 treatments) in ten replications. The replications were made from artificial diets (food and refood) made with dry steam crushed from sugar cane cultivars stems, except for one of them considered standard diet. The cultivars used were: RB867515, RB855453, RB855536, CTC 15, CTC 9, SP80-1842, SP79-1011, SP89-1115, SP81-3250 and SP87-365. In the evaluation biological characteristics of the insect considered were: larval development (days), larval viability (%), pupal development (days), pupal weight (g), pupal viability (%), period of hatched larvae to adults emergence (days), total viability (%) and adults longevity without food (days). The generalized Mahalanobis distance (D-2) for the cluster analysis by the method of average linkage between groups (UPGMA) and Tocher's method optimization was determined. Four and five groups were formed, respectively, by the method of average linkage between groups (UPGMA) and Tocher's method optimization. We concluded that the cultivar CTC 15 standed out as highly susceptible to D. saccharalis, while the cultivar SP87-365 behaved as moderately resistant by antibiosis to D. saccharalis.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Pós-graduação em Agronomia (Produção Vegetal) - FCAV

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Fire blight, caused by the gram negative bacterium Erwinia amylovora, is one of the most destructive bacterial diseases of Pomaceous plants. Therefore, the development of reliable methods to control this disease is desperately needed. This research investigated the possibility to interfere, by altering plant metabolism, on the interactions occurring between Erwinia amylovora, the host plant and the epiphytic microbial community in order to obtain a more effective control of fire blight. Prohexadione-calcium and trinexapac-ethyl, two dioxygenase inhibitors, were chosen as a chemical tool to influence plant metabolism. These compounds inhibit the 2-oxoglutarate-dependent dioxygenases and, therefore, they greatly influence plant metabolism. Moreover, dioxygenase inhibitors were found to enhance plant resistance to a wide range of pathogens. In particular, dioxygenase inhibitors application seems a promising method to control fire blight. From cited literature, it is assumed that these compounds increase plant defence mainly by a transient alteration of flavonoids metabolism. We tried to demonstrate, that the reduction of susceptibility to disease could be partially due to an indirect influence on the microbial community established on plant surface. The possibility to influence the interactions occurring in the epiphytic microbial community is particularly interesting, in fact, the relationships among different bacterial populations on plant surface is a key factor for a more effective biological control of plant diseases. Furthermore, we evaluated the possibility to combine the application of dioxygenase inhibitors with biological control in order to develop an integrate strategy for control of fire blight. The first step for this study was the isolation of a pathogenic strain of E. amylovora. In addition, we isolated different epiphytic bacteria, which respond to general requirements for biological control agents. Successively, the effect of dioxygenase inhibitors treatment on microbial community was investigated on different plant organs (stigmas, nectaries and leaves). An increase in epiphytic microbial population was found. Further experiments were performed with aim to explain this effect. In particular, changes in sugar content of nectar were observed. These changes, decreasing the osmotic potential of nectar, might allow a more consistent growth of epiphytic bacteria on blossoms. On leaves were found similar differences as well. As far as the interactions between E. amylovora and host plant, they were deeply investigated by advanced microscopical analysis. The influence of dioxygenase inhibitors and SAR inducers application on the infection process and migration of pathogen inside different plant tissues was studied. These microscopical techniques, combined with the use of gpf-labelled E. amylovora, allowed the development of a bioassay method for resistance inducers efficacy screening. The final part of the work demonstrated that the reduction of disease susceptibility observed in plants treated with prohexadione-calcium is mainly due to the accumulation of a novel phytoalexins: luteoforol. This 3-deoxyflavonoid was proven to have a strong antimicrobial activity.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Olive fruit fly Bactrocera oleae (Rossi) (Diptera: Tephritidae) is a major olive pest in the Mediterranean basin where increasing insecticide resistance has enhanced damage and necessitates more reliance on other control strategies, such as biological control. Provision of floral resources has been reported to improve the effectiveness of natural enemies. Here, we tested the effect of six plant nectars and two honeydew sources on the survival of Psyttalia concolor (Szépligeti) (Hymenoptera: Braconidae), a parasitoid wasp used in the biological control of olive fruit fly. Our results showed a positive effect on survival associated with nectars of Anchusa azurea Mill., Rosmarinus officinalis L., Lavatera cretica L. and Calamintha nepeta (L.) Savi, while honeydew proved to be a valuable alternative food source. When offering flowers directly to insects, Anchusa azurea, Lavatera cretica, and Foeniculum vulgare L. were found to be the most beneficial species, indicating also that P. concolor feeds predominantly on shallow corollas.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Neste trabalho, avaliou-se a adição de células íntegras de levedura e seus derivados em dietas para juvenis de tilápia do Nilo. Foram utilizados 144 juvenis machos de tilápia (peso médio de 52,1g) distribuídos em 12 tanques de fibra de vidro (250L), em delineamento inteiramente casualizado, composto por quatro tratamentos e três repetições. Os peixes foram alimentados ad libitum, duas vezes ao dia durante 60 dias, com dietas isoproteicas (28% PB) e isocalóricas (2.900kcal de ED kg-1) contendo levedura íntegra de cana-de-açúcar (LI), levedura autolisada (LA) e parede celular (PC) adicionados na proporção de 25% da proteína bruta total, comparadas com uma dieta controle (CO), sem adição de levedura. Não foram observadas diferenças significativas para conversão alimentar aparente e taxa de eficiência protéica. No entanto, o ganho em peso foi melhor nos peixes alimentados com as dietas LA (114,70g) e PC (131,03g), assim como em relação à taxa de crescimento específico (LA=1,79 e PC=1,93%), à proteína bruta no ganho de peso (LA=14,45 e PC=15,62%) e ao conteúdo corporal proteico (LA=14,89 e PC=15,67g 100g-1). As frações, a parede celular e a levedura autolisada de cana-de-açúcar podem ser utilizadas em dietas para juvenis de tilápia.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The commercial sugar cane spits redistillation decreased up to 92,5% their ethyl carbamate (EC) original content. Quantitative analysis of EC in 15 samples of sugar cane spirit (alembic and column), fresh distilled and collected in situ demonstrated that the urethane is formed mostly after distillation. The average time to achieve the complete EC formation is independent of the diffuse light presence and of the distillation apparatus used. The k obs for urethane formation at 25 ºC was calculate as (3,3 ± 0,5) x 10-5/s and the activation parameters are: ΔH‡ 34 kcal/mol; ΔS‡ - 69 cal/mol K; and ΔG‡ 54 kcal/mol.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Three welding procedures used to rebuild worn shafts in sugar cane mills were analysed: two submerged arc welding processes and one flux cored arc welding (FCAW) process. Sliding wear tests were in accordance with ASTM G 77 standard, using rings of welding material, blocks of bronze SAE 67, and oil as lubricant. The worn surfaces of rings and blocks were analysed by scanning electron microscopy to determine the wear mechanisms. High contact pressure, high operating temperature, and low relative speed were applied in sliding wear tests to match the conditions in sugar cane mills. Transferred material and evidence of adhesive junctions were detected. Additionally, hardened fragments produced abrasive grooves on the worn surfaces. The welding deposits that presented strong adhesion on the worn surface showed higher mass loss than the materials that presented more abrasive characteristics. Plastic mechanical properties were measured and related to the mass loss. The tested materials presented similar hardness but different yield stress and hardening coefficient. A relationship between wear, strain hardening coefficient, and yield stress was found. The welding deposit that presented the highest hardening coefficient showed the highest mass loss, with evidence of severe adhesion on the worn surface.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Grapholita molesta (Lepidoptera: Tortricidae) is one of the main pests of peach trees in Brazil, causing fruit losses of 3-5%. Among possible biological control agents, Trichogramma pretiosum (Hymenoptera: Trichogrammatidae) has been found in peach orchards. Our objectives were to study the rearing of T pretiosum in eggs of G. molesta and Anagasta kuehniella (Lepidoptera: Pyralidae), and select lineages of this parasitoid that have the potential to control G. molesta. Selection of best lineages was made from 5 populations of T pretiosum collected from organically-cultivated peach orchards. The study was done under controlled temperature (25 +/- 2 degrees C), relative humidity (70 +/- 10%) and 14:10 h (light:dark) photoperiod conditions. Grapholita molesta eggs were found to be adequate hosts for the development of T pretiosum, and the parameters for number of parasitized eggs, percent parasitized eggs, and sex ratio were similar to those for A. kuehniella eggs. The highest rate of parasitism of G. molesta eggs occurred in eggs with up to 48 h of embryonic development. Among the lineages of T pretiosum that were collected, HO8, PO8, PEL, and L3M showed the best biological performance and are therefore indicated for semi-field and field studies for biological control of oriental fruit moth.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Background: The Brazilian Amazon has suffered impacts from non-sustainable economic development, especially owing to the expansion of agricultural commodities into forest areas. The Tangara da Serra region, located in the southern of the Legal Amazon, is characterized by non-mechanized sugar cane production. In addition, it lies on the dispersion path of the pollution plume generated by biomass burning. The aim of this study was to assess the genotoxic potential of the atmosphere in the Tangara da Serra region, using Tradescantia pallida as in situ bioindicator. Methods: The study was conducted during the dry and rainy seasons, where the plants were exposed to two types of exposure, active and passive. Results: The results showed that in all the sampling seasons, irrespective of exposure type, there was an increase in micronucleus frequency, compared to control and that it was statistically significant in the dry season. A strong and significant relationship was also observed between the increase in micronucleus incidence and the rise in fine particulate matter, and hospital morbidity from respiratory diseases in children. Conclusions: Based on the results, we demonstrated that pollutants generated by biomass burning in the Brazilian Amazon can induce genetic damage in test plants that was more prominent during dry season, and correlated with the level of particulates and elevated respiratory morbidity.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Pathogenicity of strains of the entomopathogenic fungus Beauveria bassiana and endophytic strains of Beauveria sp against the bovine tick Rhipicephalus (Boophilus) microplus was tested in laboratory bioassays and under field conditions. Suspensions containing 10(5), 10(7) and 10(9) conidia/mL were prepared of each fungal strain for laboratory bioassays. The ticks were maintained at 28 degrees C, 90 +/- 5% relative humidity, and the following variables were evaluated: initial female weight, egg weight, hatching percentage, reproductive efficiency, and percentage control. For tests under field conditions, a Beauveria suspension containing 10(6) conidia/mL was sprayed on tick-infested cows. After 72 h, the ticks were collected to estimate mortality under field conditions. Laboratory bioassays showed a mortality of 20 to 50% of the ticks seven days after inoculation with 10(7) Beauveria conidia/mL. Under field conditions 10(6) Beauveria conidia/mL induced 18-32% mortality. All Beauveria strains were effective in biological control of R. (Boophilus) microplus under laboratory and field test conditions. This is the first demonstration that endophytic fungi can be used for biological control of the cattle tick; this could help reduce environmental contamination by diminishing the need for chemical acaricides. Two endophytic strains were isolated from maize leaves and characterized by molecular sequencing of 5.8S rDNA ITS1 and ITS2 and morphological analyses of conidia. We found that these two endophytic Beauveria isolates, designated B95 and B157, are close to Beauveria amorpha.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The main objective of this work was to investigate three packing materials (polyurethane foam, sugar-cane bagasse, and coconut fibre) for biofiltration of a gaseous mixture containing hydrogen sulphide (H(2)S). Mixed cultures were obtained from two sources, aerated submerged biofilters and activated sludge, and were utilised as inoculums. Biofilters reached 100% removal efficiency after two clays of operation. The empty bed residence time was 495 for each of the biofilters. The reactors were operated simultaneously, and the inlet concentrations of H(2)S varied between 184 and 644 ppmv during the long-term continuous operation of the biofilters (100 clays). Average removal efficiencies remained above 99.3%, taking into consideration the entire period of operation. Average elimination capacities reached by the biofilters packed with polyurethane foam, coconut fibre, and sugarcane bagasse were in the range of 17.8-66.6; 18.9-68.8, and 18.7-72.9g m(-3) h(-1), respectively. Finally, we concluded that the packing materials tested in this work are appropriate for the long-term biofiltration of hydrogen sulphide. (C) 2010 Elsevier B.V. All rights reserved.