Accurate molecular structures of chlorothiazide and hydrochlorothiazide by joint refinement against powder neutron and X-ray diffraction data

The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.

A powder neutron diffraction study of the metallic ferromagnet Co3Sn2S2

Variable-temperature powder neutron diffraction data reveal that Co3Sn2S2 crystallizes in the shandite structure (space group R (3) over barm, a = 5.36855(3)angstrom, c = 13.1903(1) angstrom at 300 K). The structural relationship between Co3Sn2S2 and the intermetallic compound CoSn, both of which contain Kagome nets of cobalt atoms, is discussed. Resistivity and Seebeck coefficient measurements for Co3Sn2S2 are consistent with metallic behaviour. Magnetic susceptibility measurements indicate that Co3Sn2S2 orders ferromagnetically at 180(10) K, with a saturation moment of 0.29 mu(B) per cobalt atom at 5 K. The onset of magnetic ordering is accompanied by marked anomalies in the electrical transport properties. (c) 2008 Elsevier Masson SAS. All rights reserve

Low-temperature single-crystal Raman and neutron-diffraction study of the hydrogenous ammonium copper(II) tutton salt and the deuterated analogue in the metastable state

Low-temperature (15 K) single-crystal neutron-diffraction structures and Raman spectra of the salts (NX4)(2)[CU(OX2)(6)](SO4)(2), where X = H or D, are reported. This study is concerned with the origin of the structural phase change that is known to occur upon deuteration. Data for the deuterated salt were measured in the metastable state, achieved by application of 500 bar of hydrostatic pressure at similar to303 K followed by cooling to 281 K and the subsequent release of pressure. This allows for the direct comparison between the hydrogenous and deuterated salts, in the same modification, at ambient pressure and low temperature. The Raman spectra provide no intimation of any significant change in the intermolecular bonding. Furthermore, structural differences are few, the largest being for the long Cu-O bond, which is 2.2834(5) and 2.2802(4) Angstrom for the hydrogenous and the deuterated salts, respectively. Calorimetric data for the deuterated salt are also presented, providing an estimate of 0.17(2) kJ/mol for the enthalpy difference between the two structural forms at 295.8(5) K. The structural data suggest that substitution of hydrogen for deuterium gives rise to changes in the hydrogen-bonding interactions that result in a slightly reduced force field about the copper(II) center. The small structural differences suggest different relative stabilities for the hydrogenous and deuterated salts, which may be sufficient to stabilize the hydrogenous salt in the anomalous structural form.

Neutron diffraction analysis on FINEMET alloys

Neutron diffraction has been used to study in situ the nanocrystallization process of Fe73.5Cu1Nb3Si22.5-xBx (x = 5, 9, and 12) amorphous alloys. Nanocrystallization results in a decrease of both the silicon content and the grain size of the Fe(Si) phase with increasing value of x. By comparing the radial distribution function peak areas with those predicted for ideal bcc and DO3 structure, it can be concluded that the ordering in DO3 Fe(Si) crystals increases with the silicon content.

X-ray diffraction from Al powder using energy dispersive technique

Using the energy dispersive x ...ray diffraction (EDXD) technique, the room temperature diffraction pattern of Al powder was obtained at diffraction angles ~ 30° and 50°. From the small angle diffraction pattern the average relative intensities (IR) of the (111), (200), and (220) lines were measured to be equal to 100, 62, and 32 respectively. From the large diffraction angle IR for the (220), (311+222), (400), (331+420), and (422) lines were measured to be 100,201,17,90, and 19.5 respectively. The diffraction pattern at those two angles were obtained at several higher temperatures to measure the change in the intensities of the Al lines. From the intensity changes the increase of the Debye- Waller temperature factor, i.e ~B(T), with respect to the value at room temperature was determined to be 0.6+0.1 at 250°C, 1.10+0.15 at 350°C, 1.45+0.20 at 450°C, and 2.20±0.35 at 550°C.

Crystal and molecular structure of the thioether-analogue of PEEK from X-ray powder data and diffraction-modelling

Analysis of X-ray powder data for the melt-crystallisable aromatic poly(thioether thioether ketone) [-S-Ar-S-Ar-CO-Ar](n), ('PTTK', Ar= 1,4-phenylene), reveals that it adopts a crystal structure very different from that established for its ether-analogue PEEK. Molecular modelling and diffraction-simulation studies of PTTK show that the structure of this polymer is analogous to that of melt-crystallised poly(thioetherketone) [-SAr-CO-Ar](n) in which the carbonyl linkages in symmetry-related chains are aligned anti-parallel to one another. and that these bridging units are crystallographically interchangeable. The final model for the crystal structure of PTTK is thus disordered, in the monoclinic space group 121a (two chains per unit cell), with cell dimensions a = 7.83, b = 6.06, c = 10.35 angstrom, beta = 93.47 degrees. (c) 2005 Elsevier Ltd. All rights reserved.

First structural analysis of a naphthalene-based poly(ether ketone): Crystal and molecular simulation from X-ray powder data and diffraction modeling

Polycondensation of 2,6-dihydroxynaphthalene with 4,4'-bis(4"-fluorobenzoyl)biphenyl affords a novel, semicrystalline poly(ether ketone) with a melting point of 406 degreesC and glass transition temperature (onset) of 168 degreesC. Molecular modeling and diffraction-simulation studies of this polymer, coupled with data from the single-crystal structure of an oligomer model, have enabled the crystal and molecular structure of the polymer to be determined from X-ray powder data. This structure-the first for any naphthalene-containing poly(ether ketone)-is fully ordered, in monoclinic space group P2(1)/b, with two chains per unit cell. Rietveld refinement against the experimental powder data gave a final agreement factor (R-wp) of 6.7%.

Modeling the structure of amorphous MoS3: a neutron diffraction and reverse Monte Carlo study

A model for the structure of amorphous molybdenum trisulfide, a-MoS3, has been created using reverse Monte Carlo methods. This model, which consists of chains Of MoS6 units sharing three sulfurs with each of its two neighbors and forming alternate long, nonbonded, and short, bonded, Mo-Mo separations, is a good fit to the neutron diffraction data and is chemically and physically realistic. The paper identifies the limitations of previous models based on Mo-3 triangular clusters in accounting for the available experimental data.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

A synchrotron powder X-ray diffraction study of the skutterudite-related phases AB1.5Te1.5 (A=Co, Rh, Ir; B= Ge, Sn)

X-ray resonant scattering has been exploited to investigate the crystal structure of the AB1.5Te1.5 phases (A = Co, Rh, Ir; B = Ge, Sn). Analysis of the diffraction data reveals that CoGe1.5Te1.5 and ASn1.5Te1.5 adopt a rhombohedral skutterudite-related structure, containing diamond-shape B2Te2 rings, in which the B and Te atoms are ordered and trans to each other. Anion ordering is however incomplete, and with increasing the size of both cations and anions, the degree of anion ordering decreases. By contrast, the diffraction data of IrGe1.5Te1.5 are consistent with an almost statistical distribution of the anions over the available sites, although some ordered domains may be present. The thermoelectric properties of these materials are discussed in the light of these results.