In vitro and in vivo studies of the Interferon-alpha action on distinct Orthobunyavirus

Oropouche, Caraparu, Guama, Guaroa and Tacaiuma viruses (Orthobunyavirus genus) cause human febrile illnesses and/or encephalitis. To achieve a therapeutical agent to prevent and/or treat these diseases we evaluated the antiviral action of Interferon-alpha (IFN-alpha) on these orthobunyaviruses. In vitro results showed that all the studied orthobunyaviruses are susceptible to antiviral action of IFN-alpha, but this susceptibility is limited and dependent on both concentration of drug and treatment period. In vivo results demonstrated that IFN-alpha present antiviral action on Oropouche and Guaroa viruses when used as a prophylactic treatment. Moreover, a treatment initiated 3 It after infection prevented the death of Guaroa virus infected-mice. Additionally, mortality of mice was related to the migration and replication of viruses in their brains. Our results suggest that IFN-alpha could be potentially useful in the prevention of diseases caused by Oropouche virus and in the prevention and/or treatment of diseases caused by Guaroa virus. (C) 2007 Elsevier B.V. All rights reserved.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Comportamento elétrico a alta temperatura de termistor cerâmico alfa-Fe2O3 com coeficiente de temperatura negativo

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Prevalência de talassemia alfa+ (deleção -3.7) na população adulta do estado do Rio Grande do Norte

Alpha thalassemia, the most common monogenic disorder in the world, is characterized by deletions of one (+-thalassemia) or both alpha genes (0-thalassemia) located on human chromosome 16 (16p13.3). The most common case of +-thalassemia is a deletion of 3.7 kb of DNA (-3.7 deletion). It is most prevalent in African and Middle East regions. In the few studies carried out in Brazilian population -3.7 deletion was the most common deletion, mainly in African descendants. This study was conducted to determine the prevalence of +- thalassemia (deletion 3.7kb) in adult population from Rio Grande do Norte. We obtained blood samples from 713 unrelated individuals of both genders, aged between 18 and 59 years old. All individuals were born in Rio Grande do Norte. The hematological indices were obtained in an automatic cell counter (Micros 60, ABX Diagnostics). The hemoglobin measurement (A2 and Fetal hemoglobin) and the profile confirmation were carried out by high performance liquid chromatography (HPLC) methodology. Genomic DNA was obtained from peripheral blood leukocytes using Illustra Blood GenomicPrep Mini Spin kit and -3.7 deletion was investigated by PCR. Among the 713 individuals studied, 80 (11,2%) presented +- thalassemia: 79 (11,1%) were heterozygous and 1 (0,1%) homozygous for the -3.7 deletion. Considering the ethnic group, negroes showed the greatest prevalence of +-thalassemia (12,5%), followed by mulattoes (12,3%) and caucasian (9,6%). Statistical comparison of hematological parameters between normal individuals and heterozygous to +-thalassemia showed significant differences in RBC (p<0,001), MCV (p<0,001), MCH (p<0,001), Hb A2 (p=0,007) as well as female hemoglobin concentration (p=0,003). This is one of the first studies to research +-thalassemia in general population of Rio Grande do Norte state and these results attest the importance of investigation of this condition to define the etiology of microcytosis and hypochromia.

Estudo imuno-histoquímico da presença de miofibroblastos e da expressão do fator transformador de crescimento-beta1, interferon gama, metaloproteinase de matriz 13 e indutor de metaloproteinases de matriz em lesões odontogênicas epiteliais

Myofibroblasts are cells that exhibit a hybrid phenotype, sharing the morphological characteristics of fibroblasts and smooth muscle cells, which is acquired during a process called differentiation. These cells then start to express -SMA, a marker that can be used for their identification. Studies suggest that myofibroblasts are related to the aggressiveness of different tumors and that TGF-1 and IFN- play a role in myofibroblast differentiation, stimulating or inhibiting this differentiation, respectively. The objective of this study was to investigate the role of myofibroblasts in epithelial odontogenic tumors, correlating the presence of these cells with the aggressiveness of the tumor. Immunohistochemistry was used to evaluate the expression of TGF-1 and IFN- in myofibroblast differentiation, as well as the expression of MMP-13, which is activated by myofibroblasts, and of EMMPRIN (extracellular matrix metalloproteinase inducer) as a precursor of this MMP. The sample consisted of 20 solid ameloblastomas, 10 unicystic ameloblastomas, 20 odontogenic keratocysts, and 20 adenomatoid odontogenic tumors. For evaluation of myofibroblasts, anti- -SMA-immunoreactive cells were quantified in connective tissue close to the epithelium. Immunoexpression of TGF-1, IFN-, MMP-13 and EMMPRIN was evaluated in the epithelial and connective tissue components, attributing scores of 0 to 4. The results showed a higher concentration of myofibroblasts in solid ameloblastomas (mean of 30.55), followed by odontogenic keratocysts (22.50), unicystic ameloblastomas (20.80), and adenomatoid odontogenic tumors (19.15) (p=0.001). No significant correlation between TGF-1 and IFN- was observed during the process of myofibroblast differentiation. There was also no correlation between the quantity of myofibroblasts and MMP-13 expression. Significant correlations were found between MMP-13 and TGF-1 (r=0.087; p=0.011), between MMP- 13 and IFN- (r=0.348; p=0.003), as well as between EMMPRIN and MMP-13 (r=0.474; p<0.001) and between EMMPRIN and IFN- (r=0.393; p=0.001). The higher quantity of myofibroblasts observed in solid ameloblastomas, odontogenic keratocysts and unicystic ameloblastomas suggests that these cells are one of the factors responsible for the more aggressive biological behavior of these tumors, although the myofibroblast population was not correlated with TGF-1, IFN-, MMP-13 or EMMPRIN. The correlation between MMP- 13 and TGF-1 suggests that the latter induces the expression of this metalloproteinase. The present results also support the well-established role of EMMPRIN as an inducer of MMP-13. Furthermore, the relationship between EMMPRIN and IFN- and between MMP-13 and IFN- suggests synergism in the antifibrotic effect of these markers

Citocinas e proteínas de fase aguda do soro como marcadores de regressão da resposta inflamatória ao tratamento da tuberculose pulmonar

OBJETIVO: Analisar o padrão de citocinas pró- e antiinflamatórias e da resposta de fase aguda (RFA) como marcadores de resposta ao tratamento da tuberculose pulmonar. MÉTODOS: Determinação dos níveis de interferon-gama (IFN-γ), tumor necrosis factor-alpha (TNF-α, fator de necrose tumoral-alfa), interleucina-10 (IL-10) e transforming growth factor-beta (TGF-β, fator transformador de crescimento-beta), pelo método ELISA, em sobrenadante de cultura de células mononucleares do sangue periférico e monócitos, assim como dos níveis de proteínas totais, albumina, globulinas, alfa-1-glicoproteína ácida (AGA), proteína C reativa (PCR) e velocidade de hemossedimentação (VHS) em 28 doentes com tuberculose pulmonar, em três tempos: antes (T0), aos três meses (T3) e aos seis meses (T6) de tratamento, em relação aos controles saudáveis, em um único tempo. RESULTADOS: Os pacientes apresentaram valores maiores de citocinas e RFA que os controles em T0, com diminuição em T3 e diminuição (TNF-α, IL-10, TGF-β, AGA e VHS) ou normalização (IFN-γ e PCR) em T6. CONCLUSÕES: PCR, AGA e VHS são possíveis marcadores para auxiliar no diagnóstico de tuberculose pulmonar e na indicação de tratamento de indivíduos com baciloscopia negativa; PCR (T0 > T3 > T6 = referência) pode também ser marcador de resposta ao tratamento. Antes do tratamento, o perfil Th0 (IFN-γ, IL-10, TNF-α e TGF-β), indutor de e protetor contra inflamação, prevaleceu nos pacientes; em T6, prevaleceu o perfil Th2 (IL-10, TNF-α e TGF-β), protetor contra efeito nocivo pró-inflamatório do TNF-α ainda presente. O comportamento do IFN-γ (T0 > T3 > T6 = controle) sugere sua utilização como marcador de resposta ao tratamento.

Endotoxemia por lipopolissacarídeo de Escherichia coli, em eqüinos: efeitos de antiinflamatórios nas concentrações sérica e peritoneal do fator de necrose tumoral alfa (TNF-alfa)

Avaliou-se a inibição da produção do fator de necrose tumoral alfa (TNF-alfa) devido ao pré-tratamento com antiinflamatório esteroidal (dexametasona) e não esteroidal (diclofenaco sódico) em eqüinos com endotoxemia induzida experimentalmente. Foram utilizados 15 cavalos machos não castrados, distribuídos em três grupos de cinco animais: controle (C), diclofenaco sódico (DS) e dexametasona (DM). A endotoxemia subletal foi induzida pela infusão intravenosa (IV) de 0,1mg/kg/pv de lipopolissacarídeo (LPS) de Escherichia coli 055:B5, administrado em 250ml de solução estéril de cloreto de sódio a 0,9%, durante 15min. Os cavalos do grupo-controle foram tratados com solução de cloreto de sódio a 9% IV. Nos animais do grupo DS, administraram-se, por via oral, 2,2mg/kg de diclofenaco sódico e, nos do grupo DM, 1,1mg/kg de dexametasona IV, respectivamente, 60 e 30min antes da infusão da endotoxina. Mensurou-se, por meio de ensaio de toxicidade com células da linhagem L929, a concentração de TNF-alfa no soro e no líquido peritoneal às 0, 1¼, 3 e 6 horas após injeção do LPS. No grupo-controle, observou-se aumento significativo de TNF-alfa sérico, em relação ao valor basal e aos grupos DS e DM, 1,15 horas após a indução da endotoxemia. No líquido peritoneal, as concentrações observadas estavam abaixo daquelas da curva padrão de TNF-alfa, não havendo diferença entre os grupos (P>0,05).

Expression of interferon-gamma, interferon-alpha and related genes in individuals with Down syndrome and periodontitis

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Prevalence and nonrandom distribution of exonic mutations in interferon regulatory factor 6 in 307 families with Van der Woude syndrome and 37 families with popliteal pterygium syndrome

Purpose: Interferon regulatory factor 6 encodes a member of the IRF family of transcription factors. Mutations in interferon regulatory factor 6 cause Van der Woude and popliteal pterygium syndrome, two related orofacial clefting disorders. Here, we compared and contrasted the frequency and distribution of exonic Mutations in interferon regulatory factor 6 between two large geographically distinct collections of families with Van der Woude and between one collection of families with popliteal pterygium syndrome. Methods: We performed direct sequence analysis of interferon regulatory factor 6 exons oil samples from three collections, two with Van der Woude and one with popliteal pterygium syndrome. Results: We identified mutations in interferon regulatory factor 6 exons in 68% of families in both Van der Woude collections and in 97% of families with popliteal pterygium syndrome. In sum, 106 novel disease-causing variants were found. The distribution of mutations in the interferon regulatory factor 6 exons in each collection was not random; exons 3, 4, 7, and 9 accounted for 80%. In the Van der Woude collections, the mutations were evenly divided between protein truncation and missense, whereas most mutations identified in the popliteal pterygium syndrome collection were missense. Further, the missense mutations associated with popliteal pterygium syndrome were localized significantly to exon 4, at residues that are predicted to bind directly to DNA. Conclusion: The nonrandom distribution of mutations in the interferon regulatory factor 6 exons suggests a two-tier approach for efficient mutation screens for interferon regulatory factor 6. The type and distribution of mutations are consistent with the hypothesis that Van der Woude is caused by haploinsufficiency of interferon regulatory factor 6. Oil the other hand, the distribution of popliteal pterygium syndrome-associated mutations suggests a different, though not mutually exclusive, effect oil interferon regulatory factor 6 function. Genet Med 2009:11(4):241-247.

Effect of interleukin-10 on the Paracoccidioides brasiliensis killing by gamma-interferon activated human neutrophils

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Down-modulation of lymphoproliferation and interferon-gamma production by beta-glucan derived from Saccharomyces cerevisiae

beta-glucan, one of the major cell wall components of Saccharomyces cerevisiae, has been found to enhance immune functions. This study investigated in vivo and in vitro effects of beta-glucan on lymphoproliferation and interferon-gamma (IFN-gamma) production by splenic cells from C57BL/6 female mice. All experiments were performed with particulate beta-glucan derived from S. cerevisiae. Data demonstrated that both, i.p administration of particulate beta-glucan (20 or 100 µg/animal) and in vitro stimulation of splenic cells (20 or 100 µg/ml of culture) decreased lymphoproliferation and IFN-gamma production induced by concanavalin A. These results suggest that beta-glucan can trigger a down-modulatory effect regulating a deleterious immune system hyperactivity in the presence of a strong stimulus.

Avaliação do perfil hematológico de portadores de talassemia alfa provenientes das regiões Sudeste e Nordeste do Brasil

A talassemia alfa é uma anemia hereditária resultante da síntese deficiente de cadeias alfa, provocando um excesso relativo de cadeias beta, que vão formar tetrâmeros identificados como hemoglobina H (Hb H) no indivíduo adulto. Para direcionar o diagnóstico laboratorial desta anemia, a análise dos índices eritrocitários, a eletroforese em acetato de celulose em pH neutro e a pesquisa de corpos de inclusão de Hb H são essenciais. O objetivo deste estudo foi traçar o perfil hematológico, por meio dos índices eritrocitários, dos portadores de talassemia alfa das regiões Sudeste e Nordeste do Brasil. Foram analisadas 1.010 amostras de sangue periférico após consentimento informado. Os índices eritrocitários como contagem de glóbulos vermelhos (RBC), dosagem de hemoglobina (HGB), hematócrito (HCT), volume corpuscular médio (VCM), hemoglobina corpuscular média (HCM) e concentração de hemoglobina corpuscular média (CHCM) foram fornecidos por aparelhos automatizados com controle de qualidade interno e externo. Para o diagnóstico de talassemia alfa foram utilizados testes de triagem e complementares para talassemias, como eletroforese em pH neutro e pesquisa de corpos de inclusão de Hb H com coloração de azul cresil brilhante. Comparando-se os valores hematológicos observados nos dois grupos, notou-se que, em ambas as regiões, os índices com valores discrepantes foram os níveis de HGB e HCT, sendo a maior freqüência de variação observada entre as mulheres. Nos portadores do fenótipo alfa talassêmico da região Nordeste, todos os índices eritrocitários estavam abaixo dos valores de normalidade. Estes resultados evidenciam a necessidade de melhor avaliação do perfil hematológico de talassemia alfa em diferentes regiões, considerando-se os interferentes ambientais para um diagnóstico mais preciso.

Obtenção in situ do compósito alfa-SiAlON-SiC

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Influência do desenvolvimento etário e da suplementação com vitamina E (acetato de DL-alfa-tocoferol) no metabolismo oxidativo dos neutrófilos de bovinos da raça Holandesa (Bos taurus)

O presente trabalho teve por objetivo analisar a influência do desenvolvimento etário e da suplementação com acetato de DL-alfa-tocoferol sobre o metabolismo oxidativo de neutrófilos, em bovinos da raça holandesa, no período do nascimento até os 150 dias de idade. Foram utilizados 20 bezerros divididos em dois grupos de dez animais. Os animais do grupo Tratamento receberam 2000UI de acetato de DL-alfa-tocoferol, por via intramuscular, ao nascimento, aos 15, 30, 60, 90 e 120 dias de idade, sendo o outro o grupo Controle, que não recebeu qualquer suplementação. em ambos os grupos, o metabolismo oxidativo dos neutrófilos demonstrou pouca atividade durante os primeiros 60 dias de vida, sendo indicativo da ineficiência deste importante mecanismo bactericida. Não foi observado efeito significativo da administração do acetato de DL-alfa-tocoferol sobre o metabolismo oxidativo de neutrófilos.

POSSIBLE MECHANISMS FOR REDUCTION OF CIRCULATING CONCENTRATIONS OF PROGESTERONE BY INTERFERON-ALPHA IN COWS - EFFECTS ON HYPERTHERMIA, LUTEAL CELLS, METABOLISM OF PROGESTERONE AND SECRETION OF LH

Experiments were performed to determine the mechanism by which recombinant bovine interferon-alpha(I)1 (rbIFN-alpha) causes an acute reduction in plasma concentrations of progesterone. In experiment 1, administration of a prostaglandin synthesis inhibitor blocked rbIFN-alpha-induced hyperthermia but did not prevent the decline in plasma concentrations of progesterone. The decline in progesterone concentrations caused by rbIFN-alpha was, therefore, not a direct consequence of the associated hyperthermia or of pathways mediated through prostaglandin synthesis. It is also unlikely that rbIFN-alpha acts to increase the clearance of progesterone since injection of rbIFN-alpha did not decrease plasma concentrations of progesterone in ovariectomized cows given an intravaginal implant of progesterone (experiment 2). In experiment 3, rbIFN-alpha did not affect basal and LH-induced release of progesterone from cultured luteal slices, indicating that rbIFN-alpha is unlikely to affect luteal function directly. Injection of rbIFN-alpha did, however, cause a decrease in plasma concentrations of LH in ovariectomized cows (experiment 4) that coincided temporally with the decrease in progesterone concentrations seen in cows having a functional corpus luteum. The present results strongly suggest that rbIFN-alpha acts to reduce secretion of progesterone by interfering with pituitary support for luteal synthesis of progesterone. The finding that rbIFN-alpha can inhibit LH secretion implies that interferon-alpha molecules should be considered among the cytokines that can regulate hypothalamic or pituitary function.