Utilizzo di una rete protesica in polipropilene in supporto all'erniorrafia perineale tradizionale nel cane

Scopo del progetto di dottorato è stato quello di mettere a punto l’utilizzo di una tecnica alternativa, rispetto a quelle riportate in letteratura, per la risoluzione dell’ernia perineale nel cane. Tale tecnica si propone di risolvere il difetto mediante l’ausilio di una rete protesica in polipropilene in supporto all’erniorrafia perineale tradizionale, mediante sutura a punti staccati dei muscoli che costituiscono il diaframma pelvico. Questa procedura risulta meno invasiva per l’animale rispetto alla tecnica che in letteratura viene definita il gold standard, ovvero la trasposizione del muscolo otturatore interno (Shaughnessy and Monnet, 2015), ed altre tecniche traspositive, quali la trasposizione del muscolo semitendinoso (Morello et al., 2015) e del gluteo superficiale (Bellenger & Canfield, 2002), con tempi di recupero postoperatori più rapidi e una gestione più semplice da parte del proprietario, pur mantenendo eccellenti outcomes. La messa a punto di questa procedura nasce dalla necessità di trovare una tecnica semplice da eseguire, che determini una chiusura del diaframma pelvico tale da evitare la comparsa di recidive e minimizzare le complicazioni post-operatorie. L’intento del progetto è stato di combinare l’erniorrafia perineale tradizionale con l’utilizzo di reti protesiche così da ricostruire il diaframma pelvico con i muscoli deputati a svolgere tale compito e fornire, tramite la rete, un maggiore supporto alla rafia, evitando le trasposizioni muscolari che comporterebbero un intervento più demolitivo e un recupero più lento da parte del paziente. Sono stati inclusi nello studio 30 cani portatori di ernia perineale, per un totale di 50 ernie, trattati con l’intervento proposto dal progetto. Di ogni caso sono stati raccolti il segnalamento, l’anamnesi, le indagini diagnostiche e i successivi follow up post-operatori considerando le eventuali complicazioni o la comparsa di recidiva dell’ernia.

Fattori che influenzano l'esame angio-TC del distretto addominale nel cane: una revisione sistematica

Lo scopo dell’AngioTC è quello di ottenere un’opacizzazione adeguata del comparto vascolare esaminato, sincronizzata all’acquisizione della scansione TC. La distribuzione del mezzo di contrasto (mdc) e l’opacizzazione dei distretti corporei, definita enhancement, è influenzata da diversi fattori: relativi al paziente, al mdc o allo scanner TC. In Medicina Veterinaria sono presenti pochi studi indirizzati a valutare l’influenza di diversi fattori sull’enhancement. La ricerca è stata condotta seguendo le linee guida PRISMA (Preferred Reporting Items for Systematic Reviews, 2020). Il database online di diversi motori di ricerca scientifici (Web of Science, PubMed, Scopus e CABAbstract) è stato esaminato mediante combinazione di diverse parole chiave. Sono stati individuati 20 studi che rispettavano i criteri di inclusione, inseriti nel corpo finale della revisione sistematica e raggruppati sulla base della categoria di appartenenza. Si è visto come la quantità di tessuto adiposo addominale sull’enhancement rappresenti un fattore che permette di ridurre la dose di mezzo di contrasto utilizzato, riducendo effetti avversi o tossicità sull’animale. Per quanto riguarda l’iniezione del mdc, un fattore in grado di influenzare maggiormente l’enhancement sembra essere la velocità di trasporto dello Iodio, piuttosto che la durata di iniezione, soprattutto a livello arterioso ed epatico. Con uno scanner lento o una durata di scansione lunga, è consigliato utilizzare una durata fissa di iniezione del mdc per l’acquisizione delle diverse fasi vascolari. Al contrario, con scanner più performanti la tecnica di bolus tracking garantisce una maggior qualità tra le varie fasi vascolari. È indicato, infine, eseguire un flush con soluzione fisiologica al termine della somministrazione di mdc per incrementare l’enhancement arterioso e ridurre la dose di mdc somministrata. Questa revisione sistematica mette in evidenza alcuni fattori e può fare da base per l’ulteriore approfondimento di alcuni di questi fattori o per la valutazione altri non ancora esaminati in Medicina Veterinaria.

Malattie immunomediate del cane e del gatto: aspetti diagnostici e terapeutici

La presente tesi di dottorato affronta alcune delle più comuni malattie immunomediate del cane e del gatto. Il manoscritto è incentrato sugli aspetti diagnostici e terapeutici in corso di: anemia emolitica immunomediata (Immune-mediated hemolytic anemia, IMHA), trombocitopenia immunomediata (Immune-mediated thrombocytopenia, ITP) e poliartrite immunomediata (Immune-mediated polyarthritis, IMP). Il capitolo 1 costituisce un’introduzione all’argomento delle malattie immunologiche; vengono sottolineati alcuni aspetti patogenetici delle singole malattie immunomediate e riassunte le difficoltà diagnostiche e terapeutiche. Il capitolo 2 riporta uno studio riguardante una popolazione di gatti con diagnosi, o sospetto diagnostico, di IMHA che evidenziava una discrepanza tra i test diagnostici per il virus della leucemia felina (Feline Leukemia Virus, FeLV). La positività FeLV al test point of care, non confermata dalla PCR del DNA provirale, lascia spazio a diverse interpretazioni. Il capitolo 3 mostra i dati relativi al confronto tra tre diversi protocolli immunosoppressivi (glucocorticoidi, glucocorticoidi+ciclosporina, glucocorticoidi+micofenolato mofetile) in una popolazione di cani con IMHA non associativa. Il confronto verteva, principalmente, sulla risposta ematologica dei pazienti, che non si è dimostrata differente tra i tre gruppi terapeutici. Il capitolo 4 riporta una revisione della letteratura riguardante l’ITP del cane e del gatto. Si tratta di una malattia eterogenea in cui le manifestazioni cliniche appaiono variabili: alcuni pazienti sono asintomatici, altri presentano dei sanguinamenti spontanei. La mancanza di criteri diagnostici standardizzati, porta il clinico a considerare l’ITP una diagnosi “ad esclusione”. Le strategie terapeutiche non si basano purtroppo su linee guida condivise, pertanto il target della terapia rimane, ad oggi, sconosciuto. Nel capitolo 5 viene posta l’attenzione su alcuni interrogativi diagnostici e terapeutici che riguardano l’IMP del cane e del gatto. La sintomatologia clinica, caratterizzata da zoppia, febbre e riluttanza al movimento, talvolta può essere subdola. Anche in questa malattia, non vi sono evidenze scientifiche circa il regime immunosoppressivo più corretto ed indicato.

Falls Among The Elderly: Risk Factors In A Population-based Study.

The aim of the present study was to identify factors associated with the occurrence of falls among elderly adults in a population-based study (ISACamp 2008). A population-based cross-sectional study was carried out with two-stage cluster sampling. The sample was composed of 1,520 elderly adults living in the urban area of the city of Campinas, São Paulo, Brazil. The occurrence of falls was analyzed based on reports of the main accident occurred in the previous 12 months. Data on socioeconomic/demographic factors and adverse health conditions were tested for possible associations with the outcome. Prevalence ratios (PR) were estimated and adjusted for gender and age using the Poisson multiple regression analysis. Falls were more frequent, after adjustment for gender and age, among female elderly participants (PR = 2.39; 95% confidence interval (95% CI) 1.47 - 3.87), elderly adults (80 years old and older) (PR = 2.50; 95% CI 1.61 - 3.88), widowed (PR = 1.74; 95% CI 1.04 - 2.89) and among elderly adults who had rheumatism/arthritis/arthrosis (PR = 1.58; 95% CI 1.00 - 2.48), osteoporosis (PR = 1.71; 95% CI 1.18 - 2.49), asthma/bronchitis/emphysema (PR = 1,73; 95% CI 1.09 - 2.74), headache (PR = 1.59; 95% CI 1.07 - 2.38), mental common disorder (PR = 1.72; 95% CI 1.12 - 2.64), dizziness (PR = 2.82; 95% CI 1.98 - 4.02), insomnia (PR = 1.75; 95% CI 1.16 - 2.65), use of multiple medications (five or more) (PR = 2.50; 95% CI 1.12 - 5.56) and use of cane/walker (PR = 2.16; 95% CI 1.19 - 3,93). The present study shows segments of the elderly population who are more prone to falls through the identification of factors associated with this outcome. The findings can contribute to the planning of public health policies and programs addressed to the prevention of falls.

Resistência à compressão e remoção de folhas da cana-de-açúcar visando à colheita mecânica

Sugarcane holds an important place in the Brazilian economy. Grate part of the sugarcane harvested still accomplished largely manually. Sugarcane harvesters available in Brazil use the technology to chop the cane into 200 to 300 mm billets to allow on the go cane transferring to transport, contradicting the traditional method of whole stalk sugarcane harvesting system. In order to make whole stalk mechanical harvesting system possible, one of the barriers to be expired is the mechanical removal of the straw. The design of a mechanism that accomplishes this operation depends directly on the knowledge of the mechanical properties of the sugarcane related to its resistance to compression and the forces necessary to remove the leaves from the stalk. Compression tests were conducted using the universal testing machine. For leaves removal test by friction, a special apparatus was designed to allow the registration of the normal and traction force. The sugarcane stalk can resist up to 4.9 MPa. With a normal pressure of 0.8 MPa, which correspond to a friction force of 315 N, it is possible to remove the leaves, independent of its location in the sugarcane stalk.

Sistema de monitoramento de perdas visíveis de cana-de-açúcar em colhedora de cana picada

In the last few years the sugar-cane mechanical harvested area has increased, especially in regions with appropriated slop. The use of this technology brings some inconveniences, such as, the increase in the percentage of extraneous matter, which causes the reduction of technological quality of the raw material, and losses in the field. Extraneous matter (trash) is composed of tops and leaves in major percentage, plus soil and roots, and eventually some metal parts. In the green cane harvest system the percentage of extraneous matter has a tendency to increase due to the great amount of vegetal matter to be processed. The increase in the blower fan speed to reduce the amount of extraneous matter can lead to an unacceptable economic level of raw material losses. The main objective of this work was, using a cane loss monitor, to evaluate and quantify the amount of visible losses of sugar cane through the primary extractor at two different fan speeds. Afterwards these losses were related to the harvester cleaning efficiency. The piezoelectric transducer shows a reasonable sensibility. The results show that the cleaning efficiency in the primary extractor (85% mean), the cane losses (between 5.68% and 2.15%) and fan speed are interrelated. The total losses and specially splinters (between 3.19% and 0.91%), showed a significant difference among the treatments.

Projeto de um cortador de base para colhedora de cana-de-açúcar utilizando otimização matemática

A base-cutter represented for a mechanism of four bars, was developed using the Autocad program. The normal force of reaction of the profile in the contact point was determined through the dynamic analysis. The equations of dynamic balance were based on the laws of Newton-Euler. The linkage was subject to an optimization technique that considered the peak value of soil reaction force as the objective function to be minimized while the link lengths and the spring constant varied through a specified range. The Algorithm of Sequential Quadratic Programming-SQP was implemented of the program computational Matlab. Results were very encouraging; the maximum value of the normal reaction force was reduced from 4,250.33 to 237.13 N, making the floating process much less disturbing to the soil and the sugarcane rate. Later, others variables had been incorporated the mechanism optimized and new otimization process was implemented .

Simulação da varredura da superfície por um cortador de base segmentado

Base cutting and feeding into harvesters of plants lying close to the ground surface require an efficient sweeping action of the cutting mechanism. It is not the case of conventional sugarcane harvesters which have rigid blades mounted on discs capable to contaminate the cane with dirt as well as damage the ratoons. The objective of this work was to simulate the sweeping performance of a segmented base cutter. The model was developed using the laws of dynamic. Simulation included two rotational speeds (400 and 600 rpm), two cutting heights (0.12 and 0.13 m) and two disk tilting angles (-10º and -12º). The simulated sweeping angle varied between 56º and 193º, which are very promising as a mean to cutting and feeding cane sticks lying on the ground. Cutting height was the variable that affected sweeping action the most. This behavior indicates the need to have an automatic control of the cutting disk height in order to keep good sweeping performance as the harvester moves forward.

Colheita de cana-de-açúcar com auxílio mecânico

Civil society and sugarcane farmer demands indicate that harvesting technology has enough limitations to jeopardize production in large sugar cane producing areas. This work analyses the current mechanical harvesting compared to a semi-mechanical harvesting proposal, on the bases of eleven characteristics considered determinant for a quick spreading of green cane harvesting on hilly areas, with lower impact on agricultural labor and farmers investment capacity.

Análise de aspectos socioeconômicos e tecnológicos da agropecuária na Bacia Hidrográfica do Rio Mogi Guaçu

Currently, owing to the occurrence of environmental problems, along with the need of environmental preservation, both the territory management of Hydrographic Basin and the conservation of natural resources have proven to have remarkable importance. Thus, the mean goal of the research is to raise and scrutinize social-economic and technologic data from the Mogi Guaçu River Hydrographic Basin (São Paulo, Brazil). The aim is to group municipalities with similar characteristics regarding the collected data, which may direct joint actions in the Hydrographic Basin Management. There were used both the methods of factorial analysis and automatic hierarchical classifications. Additionally, there is going to be applied a Geographical Information System to represent the outcomes of the methods aforementioned, through the evolvement of a geo-referenced database, which will allow the obtainment of information categorically distributed including theme maps of interest. The main characteristics adopted to group the municipalities were: agricultural area, sugar cane production, small farms, animal production, number of agriculture machinery and equipments and agricultural income. The methodology adopted in the Mogi Guaçu River Hydrographic Basin will be analyzed vis-à-vis its appropriateness on basin management, as well as the possibility of assisting the studies on behalf of the São Paulo Hydrographic Basin groups, to regional development.

Avaliação de perdas invisíveis na colheita mecanizada em dois fluxos de massa de cana-de-açúcar

In this work the performance of a sugar cane chopped harvester was analysed when fed with two sugar cane mass flows, measuring the invisible losses, which are impossible to measure in the field, harvester sugar cane cleaning efficiency and air velocity on extractors exit. The trial was done under controlled conditions at Copersucar Technology Center in January 2000. The results showed that the flow of sugar cane through the harvester doesn't influence the magnitudes of total invisible losses and raw material cleaning efficiency. The mean air velocity on the primary extractors exit was 12.0 m s-1, and 9.2 m s-1 on the secondary extractor, with a coefficient of variation of 21%, indicating that the poor cleaning performance of the harvester could be related to air velocity difference inside the extractor. Analyzing the data collected in the trials, it was possible to conclude that invisible losses in sugar cane harvester were 10% and the cleaning efficiency was 87%.

Sistema de sincronismo entre a colhedora de cana-de-açúcar e o veículo de transbordo

One of the problems found in mechanical harvest of sugar cane is the lack of synchronism between the harvest machine and the infield wagon, causing crop losses as well as operational capacity. The objective of the present research was to design a system capable of helping to synchronize the sugar cane harvest machine with the wagon. The communication between tractor and harvest machine is wireless. Two ultrasound sensors coupled to the elevator and a microprocessor manage such information, generating a correct synchronization among the machines. The system was tested in laboratory and on field performing its function adequately, maintaining the two machines in synchronization, indicating and alerting the operators their relative positions. The developed system reduced the sugar cane lost in 60 kg ha-1 comparing to the harvest with the system turned off.

Perfis temporais NDVI MODIS, na cana-soca, de maturação tardia

This paper describes the development of a relational database and a tool for viewing MODIS NDVI temporal profile, using data from MOD09Q1 product, specifically the surface bidirectional reflectance factor relative to the RED and NIR wavelength, mosaic of 8-day temporal composition, and the quality band, in sugarcane fields in the state of São Paulo, for analysis of the late stubble-cane maturation. From sugarcane farms were obtained the historical data about yield, soil, variety, location of the each pixel for each subregion monitored. All data were integrated in a database developed in PostgreSQL. The tool was implemented using Java language and allowed a fast and automatic way of analyzing sugarcane phenological patterns. It concluded that the MODIS NDVI temporal profile using data from MOD09Q1 product is able to subsidize the monitoring of phenological changes in the sugarcane.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Suplementação com caldo de cana de açucar comparado com outros carboidratos na reposição do glicogenio e cinetica de biomarcadores pos-exercicio agudo em ratos

Universidade Estadual de Campinas . Faculdade de Educação Física