Angiotensin II modulates CD40 expression in vascular smooth muscle cells

The signalling pathway CD40/CD40L (CD40 ligand) plays an important role in atherosclerotic plaque formation and rupture. AngII (angiotensin II), which induces oxidative stress and inflammation, is also implicated in the progression of atherosclerosis. In the present study, we tested the hypothesis that AngII increases CD40/CD40L activity in vascular cells and that ROS (reactive oxygen species) are part of the signalling cascade that controls CD40/CD40L expression. Human CASMCs (coronary artery smooth muscle cells) in culture exposed to IL (interleukin)-1 beta or TNF-alpha (tumour necrosis factor-a) had increased superoxide generation and enhanced CD40 expression, detected by EPR (electron paramagnetic resonance) and immunoblotting respectively. Both phenomena were abolished by previous incubation with membrane-permeant antioxidants or cell transfection with P22(phox) antisense. AngII (50-200 nmol/l) induced an early and sustained increase in CD40 mRNA and protein expression in CASMCs, which was blocked by treatment with antioxidants. Increased CD40 expression led to enhanced activity of the pathway, as AngII-treated cells stimulated with recombinant CD40L released higher amounts of IL-8 and had increased COX-2 (cyclo-oxygenase-2) expression. We conclude that AngII stimulation of vascular cells leads to a ROS-dependent increase in CD40/CD40L signalling pathway activity. This phenomenon may be an important mechanism modulating the arterial injury observed in atherosclerosis-related vasculopathy.

Identification of protein-coding and intronic noncoding RNAs down-regulated in clear cell renal carcinoma

The clear cell subtype of renal cell carcinoma (RCC) is the most lethal and prevalent cancer of the urinary system. To investigate the molecular changes associated with malignant transformation in clear cell RCC, the gene expression profiles of matched samples of tumor and adjacent non-neoplastic tissue were obtained from six patients. A custom-built cDNA microarray platform was used, comprising 2292 probes that map to exons of genes and 822 probes for noncoding RNAs mapping to intronic regions. Intronic transcription was detected in all normal and neoplastic renal tissues. A subset of 55 transcripts was significantly down-regulated in clear cell RCC relative to the matched nontumor tissue as determined by a combination of two statistical tests and leave-one-out patient cross-validation. Among the down-regulated transcripts, 49 mapped to untranslated or coding exons and 6 were intronic relative to known exons of protein-coding genes. Lower levels of expression of SIN3B, TRIP3, SYNJ2BP and NDE1 (P<0.02), and of intronic transcripts derived from SND1 and ACTN4 loci (P<0.05), were confirmed in clear cell RCC by Real-time RT-PCR. A subset of 25 transcripts was deregulated in additional six nonclear cell RCC samples, pointing to common transcriptional alterations in RCC irrespective of the histological subtype or differentiation state of the tumor. Our results indicate a novel set of tumor suppressor gene candidates, including noncoding intronic RNAs, which may play a significant role in malignant transformations of normal renal cells. (C) 2008 Wiley-Liss, Inc.

Interaction of cationic bilayer fragments with a model oligonucleotide

The interaction between cationic bilayer fragments and a model oligonucleotide was investigated by differential scanning calorimetry, turbidimetry, determination of excimer to monomer ratio of 2-(10-(1-pyrene)-decanoyl)-phosphatidyl-choline in bilayer fragment dispersions and dynamic light scattering for sizing and zeta-potential analysis. Salt (Na(2)HPO(4)), mononucleotide (2`-deoxyadenosine-5`-monophosphate) or poly (dA) oligonucleotide (3`-AAA AAA AAA A-5`) affected structure and stability of dioctadecyldimethylammonium bromide bilayer fragments. Oligonucleotide and salt increased bilayer packing due to bilayer fragment fusion. Mononucleotide did not reduce colloid stability or did not cause bilayer fragment fusion. Charge neutralization of bilayer fragments by poly (dA) at 1:10 poly (dA):dioctadecyldimethylammonium bromide molar ratio caused extensive aggregation, maximal size and zero of zeta-potential for the assemblies. Above charge neutralization, assemblies recovered colloid stability due to charge overcompensation. For bilayer fragments/poly (dA), the nonmonotonic behavior of colloid stability as a function of poly (dA) concentration was unique for the oligonucleotide and was not observed for Na(2)HPO(4) or 2`-deoxyadenosine-5`-monophosphate. For the first time, such interactions between cationic bilayer fragments and mono- or oligonucleotide were described in the literature. Bilayer fragments/oligonucleotide assemblies may find interesting applications in drug delivery. (c) 2010 Elsevier B.V. All rights reserved.

Conserved tissue expression signatures of intronic noncoding RNAs transcribed from human and mouse loci

It has been postulated that noncoding RNAs (ncRNAs) are involved in the posttranscriptional control of gene expression, and may have contributed to the emergence of the complex attributes observed in mammalians. We show here that the complement of ncRNAs expressed from intronic regions of the human and mouse genomes comprises at least 78,147 and 39,660 transcriptional units, respectively. To identify conserved intronic sequences expressed in both humans and mice, we used custom-designed human cDNA microarrays to separately interrogate RNA from mouse and human liver, kidney, and prostate tissues. An overlapping tissue expression signature was detected for both species, comprising 198 transcripts; among these, 22 RNAs map to intronic regions with evidence of evolutionary conservation in humans and mice. Transcription of selected human-mouse intronic ncRNAs was confirmed using strand-specific RT-PCR. Altogether, these results support an evolutionarily conserved role of intronic ncRNAs in human and mouse, which are likely to be involved in the fine tuning of gene expression regulation in different mammalian tissues. (C) 2008 Elsevier Inc. All rights reserved.

Caracterização funcional de dois cDNAs homólogos à ciclofilina e à proteína reprimida por auxina (ARP) identificados em bibliotecas subtrativas a para floração em tomateiro

Flowering is a fundamental process in the life cycle for plant. This process is marked by vegetative to reproductive apical meristem conversion, due to interactions between several factors, both internal and external to plant. Therefore, eight subtractive libraries were constructed using apical meristem induced or not induced for two contrasting species: Solanum lycopersicum cv. Micro-Tom and Solanum pimpinellifolium. Several cDNAs were identified and among these, were selected two cDNAs: one homologous cDNA to cyclophilin (LeCYP1) and the other to Auxin repressed protein (ARP). It has observed that LeCYP1 and ARP genes are important in the developmental process to plants. In silico analysis, were used several databases with the exclusion criterion E-value <1.0x10-15. As a result, conservation was observed for proteins analyzed by means of multiple alignments and the presence of functional domains. Then, overexpression cassettes were constructed for the ARP cDNA in sense and antisense orientations. For this step, it was used the CaMV35S promoter. The cDNA orientation (sense or antisense) in relation to the promoter was determined by restriction enzymes and sequencing. Then, this cassette was transferred to binary vector pZP211 and these cassettes were transferred into Agrobacterium tumefaciens LBA4404. S. lycopersicum cv. Micro-Tom (MT) and MT-Rg1 plants were transformed. In addition, seedlings were subjected to hormone treatments using a synthetic auxin (- naphthalene acetic acid) and cyclosporin A (cyclophilin inhibitor) treatments and it was found that the hormone treatment there were changes in development of lateral roots pattern, probably related to decreases in auxin signaling caused by reduction of LeCYP1 in MT-dgt plants while cyclosporin A treatments, there was a slight delay in flowering in cv. MT plants. Furthermore, assay with real-time PCR (RT-qPCR) were done for expression level analysis from LeCYP1 and ARP in order to functionally characterize these sequences in tomato plants.

Caracterização funcional de dois cDNAs de cana-de- açúcar : PKCI e SHAGGY

Flowering is controlled by several environmental and endogenous factors, usually associated with a complex network of metabolic mechanisms. The gene characterization in Arabidopsis model has provided much information about the genetic and molecular mechanisms that control flowering process. Some of these genes had been found in rice and maize. However, in sugarcane this processe is not well known. It is known that early flowering may reduce its production up to 60% at northeast conditions. Considering the impact of early flowering in sugarcane production, the aim of this work was to make the gene characterization of two cDNAs previously identified in subtractive cDNA libraries: scPKCI and scSHAGGY. The in silico analysis showed that these two cDNAs presented both their sequence and functional catalytic domains conserved. The results of transgenic plants containing the overexpression of the gene cassette scPKCI in sense orientation showed that this construction had a negative influence on the plant development as it was observed a decrease in plant height and leaf size. For the scPKCI overexpression in antisense orientation it was observed change in the number of branches from T1 transgenic plants, whereas transgenic T2 plants showed slow development during germination and initial stages of development. The other cDNA analyzed had homology to SHAGGY protein. The overexpression construct in sense orientation did not shown any effect on development. The only difference observed it was an increase in stigma structure. These results allowed us to propose a model how these two genes may be interact and affect floweringdevelopment.

Análise de cDNAs identificados em bibliotecas substrativas de cDNA para floração de variedades de cana-de-açúcar cultivadas no Rio Grande do Norte(RN): fator de transição NAC, Calmodulina e Fosfatidiltransferase

The flowering is a physiological process that it is vital for plants. This physiological process has been well studied in the plant model Arabidopsis, but in sugarcane this process is not well known. The transition of the shoot apical meristem from vegetative to flowering is a critical factor for plant development. At Brazil northeastern region, the transition to flowering in sugarcane has an important effect as it may reduce up to 60% its production. This is a consequence of the sugar translocation from stalks to the shoot apical meristem which is necessary during the flowering process. Therefore, the aim of this work was to explore and analyze cDNAs previously identified using subtractive cDNA libraries. The results showed that these cDNAs showed differential expression profile in varieties of sugarcane (early x late flowering). The in silico analysis suggested that these cDNAs had homology to calmodulin, NAC transcription factor and phosphatidylinositol, a SEC14, which were described in the literature as having a role in the process of floral development. To better understand the role of the cDNA homologous to calmodulin, tobacco plants were transformed with overexpression cassettes in sense and antissense orientation. Plants overexpressing the cassette in sense orientation did not flowered, while plants overexpressing the cassette in the antissense orientation produced flowers. The data obtained in this study suggested the possible role from CAM sequence, SEC14 and NAC in the induction/floral development pathway in sugarcane, this is the first study in order to analyze these genes in the sugarcane flowering process.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Amplificação gênica alelo-específica na caracterização das hemoglobinas S, C e D e as interações entre elas e talassemias beta

INTRODUÇÃO: As hemoglobinopatias resultam de alterações hereditárias, sendo prevalentes em muitas regiões do mundo, mas atingem a população brasileira de forma significativa. Elas são decorrentes de alterações em genes estruturais responsáveis pelo aparecimento das hemoglobinas variantes e/ou em genes reguladores, resultando nas talassemias. A identificação dessas patologias tem sido rotineiramente realizada por procedimentos eletroforéticos, contudo nossa experiência laboratorial evidencia que as mesmas nem sempre apresentam resoluções suficientes para a correta caracterização da mutação. CASUÍSTICAS E MÉTODOS: O propósito deste trabalho foi estabelecer uma metodologia válida para a caracterização das hemoglobinas S, C e D em homozigose ou heterozigose, e suas possíveis interações, baseada na amplificação gênica alelo-específica (PCR-AE) com a utilização de primers sense, antisense e primers que se acoplam na posição do alelo mutante e na respectiva posição do alelo normal. RESULTADOS E DISCUSSÃO: Os resultados evidenciaram a validade dessa metodologia na caracterização das mutações, sendo esse procedimento de fácil realização, reprodutível e possível de ser aplicado em um significativo número de amostras.

Caracterização de dois cDNAs homológos e uma AP endonuclease em cana-de-açúcar

The genome of all organisms is subject to injuries that can be caused by endogenous and environmental factors. If these lesions are not corrected, it can be fixed generating a mutation which can be lethal to the organisms. In order to prevent this, there are different DNA repair mechanisms. These mechanisms are well known in bacteria, yeast, human, but not in plants. Two plant models Oriza sativa and Arabidopsis thaliana had the genome sequenced and due to this some DNA repair genes have been characterized. The aim of this work is to characterized two sugarcane cDNAs that had homology to AP endonuclease: scARP1 and scARP3. In silico has been done with these two sequences and other from plants. It has been observed domain conservation on these sequences, but the cystein at 65 position that is a characteristic from the redox domain in APE1 protein was not so conservated in plants. Phylogenetic relationship showed two branches, one branch with dicots and monocots sequence and the other branch with only monocots sequences. Another approach in order to characterized these two cDNAs was to construct overexpression cassettes (sense and antisense orientation) using the 35S promoter. After that, these cassettes were transferred to the binary vector pPZP211. Furthermore, previously in the laboratory was obtained a plant from nicotiana tabacum containing the overexpression cassette in anti-sense orientation. It has been observed that this plant had a slow development and problems in setting seeds. After some manual crossing, some seeds were obtained (T2) and it was analyzed the T2 segregation. The third approach used in this work was to clone the promoter region from these two cDNAs by PCR walking. The sequences obtained were analyzed using the program PLANTCARE. It was observed in these sequences some motives that may be related to oxidative stress response

Leishmania amazonensis: Partial purification and study of the biochemical properties of the telomerase reverse transcriptase activity from promastigote-stage

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Hypothalamic melanin-concentrating hormone is induced by cold exposure and participates in the control of energy expenditure in rats

Short-term cold exposure of homeothermic animals leads to higher thermogenesis and food consumption accompanied by weight loss. An analysis of cDNA-macroarray was employed to identify candidate mRNA species that encode proteins involved in thermogenic adaptation to cold. A cDNA-macroarray analysis, confirmed by RT-PCR, immunoblot, and RIA, revealed that the hypothalamic expression of melanin-concentrating hormone (MCH) is enhanced by exposure of rats to cold environment. The blockade of hypothalamic MCH expression by antisense MCH oligonucleotide in cold-exposed rats promoted no changes in feeding behavior and body temperature. However, MCH blockade led to a significant drop in body weight, which was accompanied by decreased liver glycogen, increased relative body fat, increased absolute and relative interscapular brown adipose tissue mass, increased uncoupling protein 1 expression in brown adipose tissue, and increased consumption of lean body mass. Thus, increased hypothalamic MCH expression in rats exposed to cold may participate in the process that allows for efficient use of energy for heat production during thermogenic adaptation to cold.

Identification of two subfamilies of micropia transposable element in species of the repleta group of Drosophila

The occurrence, number of insertion sites and antisense RNA expression of micropia transposable element were studied in 26 species that belong to three subgroups (mercatorum, mulleri and hydei) of repleta group of Drosophila. Under high specific PCR, micropia sequences were detected in 11 species, but under less stringent condition, this retrotransposon was detected in all species. The widespread distribution of micropia suggests that this element was already present at the common ancestor of the repleta group of Drosophila. Southern blot analysis showed a variation from 0 to 17 different insertion sites and the occurrence of male-specific sequences. We found that the expression of the 1.0 kb micropia antisense RNA is variable among the species and tissues (soma and testis), which suggests that more than one mechanism regulates transposition in these species. Variation of amplification by PCR and of antisense RNA expression, as well as divergence of nucleotide sequences among the species allow us to suggest that at least two subfamilies of micropia transposable element are harbored by the genome of this species group.

Exercise training decreases mitogen-activated protein kinase phosphatase-3 expression and suppresses hepatic gluconeogenesis in obese mice

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Products for the treatment of inflammatory bowel disease: a patent review (2013-2014)

Introduction: Inflammatory bowel disease (IBD) consists of Crohn's disease, ulcerative colitis and an unspecific IBD. The unclear etiology of IBD is a limiting factor that complicates the development of new pharmacological treatments and explains the high frequency of refractory patients to current drugs, including both conventional and biological therapies. In view of this, recent progress on the development of novel patented products to treat IBD was reviewed.Areas covered: Evaluation of the patent literature during the period 2013 - 2014 focused on chemical compounds, functional foods and biological therapy useful for the treatment of IBD.Expert opinion: Majority of the patents are not conclusive because they were based on data from unspecific methods not related to intestinal inflammation and, when related to IBD models, few biochemical and molecular evaluations that could be corroborating their use in human IBD were presented. On the other hand, methods and strategies using new formulations of conventional drugs, guanylyl cyclase C peptide agonists, compounds that influence anti-adhesion molecules, mAbs anti-type I interferons and anti-integrin, oligonucleotide antisense Smad7, growth factor neuregulin 4 and functional foods, particularly fermented wheat germ with Saccharomyces cerevisiae, are promising products for use in the very near future.