988 resultados para Population Expansion
Resumo:
This study has calculated the potential impact of hormone replacement therapy (HRT) on breast cancer incidence in Australia and has estimated how changes in prescribing HRT to women could affect this risk. The effects of HRT on breast cancer incidence was estimated using the attributable fraction technique with prevalence data derived from the 2001 Australian Health Survey and published rates of breast cancer relative risks from HRT use. In Australia, 12% of adult women were current HRT users and in 2001, 11783 breast cancers were reported. Of these, 1066 (9%) were potentially attributable to HRT. Restricting HRT use to women aged less than 65 years, ceasing HRT prescribing after 10 years or limiting combined oestrogen and progesterone HRT to five years (but otherwise keeping prescription levels to 2001 levels) may reduce the annual breast cancer caseload by 280 (2.4%), 555 (4.7%) or 674 (5.7%), respectively. In conclusion, this study has demonstrated that when HRT prevalence is relatively high, the effect on breast cancer incidence in the population will be significant. A small modification in HRT prescribing practices may impact breast cancer incidence in Australia with associated financial and health care provision implications. (C) 2005 Elsevier Ltd. All rights reserved.
Resumo:
Background: Studies investigating the association between alcohol use and cognitive disorders in the elderly population have produced divergent results. Moreover, the role of alcohol in cognitive dysfunction is not clear. The aims of this study were to estimate the prevalence of alcohol-related problems in an elderly population from Brazil and to investigate their association with cognitive and functional impairment (CFI) and dementia. Methods: A community-based cross-sectional study was performed. A sample of 1,145 elderly people was examined in 2 phases. Several instruments were utilized in the first phase: the CAGE questionnaire was used to identify potential cases of alcohol-related problems, and a screening test for dementia was used to estimate CFI. The CAMDEX interview (Cambridge Examination) and DSM-IV (Diagnostic and Statistical Manual of Mental Disorders, 4th edition) criteria were used for the clinical diagnosis of dementia in the second phase. Results: ""Heavy alcohol use"" (CAGE >= 2) was found in 92 subjects (prevalence: 8.2%). It was associated with gender (males, p < 0.001), low education (only in females, p = 0.002), and low socioeconomic level (p = 0.001, in females; p = 0.002, in males). The Mini Mental State Examination exhibited a nonlinear relationship with alcohol-related problems in females; ""mild-moderate alcohol use"" (CAGE < 2) presented the highest score. A significant association between alcohol-related problems and cognitive dysfunction was found only in females. ""Heavy alcohol use"" was associated with higher CFI and dementia rates compared to ""mild-moderate alcohol use"" (p = 0.003 and p < 0.001, respectively). ""Mild-moderate alcohol use"" had a tendency of association with lower CFI and dementia rates when compared to ""no alcohol use"" (p = 0.063 and 0.050, respectively). Conclusion: Our findings suggest that alcohol use does not have a linear relationship with cognitive decline.
Resumo:
To analyse breast cancer incidence trends in New South Wales (NSW), Australia, in relation to population-based mammography screening targeting women aged 50 to 69 years. Trends in age-specific incidence of invasive breast cancers in NSW women aged >= 40 years were examined in relation to mammography screening rates and screening cancer detection rates. Incidence of invasive breast cancer in NSW women increased in all age-groups over 1972 to 2002. The incidence trend for women aged 50 to 69 years showed that the steepest rise was associated with increased participation in population-based mammography screening, which was implemented from 1988 and achieved state-wide coverage in 1995. The elevated incidence of invasive cancer significantly exceeded pre-screening levels, and persisted after rates of initial screens declined. This elevated incidence was sustained by the contribution of cancers diagnosed through subsequent screening, and resulted from increased cancer detection rates in subsequent screens. The recent increase in invasive breast cancer incidence in NSW is associated with mammography screening, and occurred mostly in the target age-group women. Persistence of higher incidence after 1994 was not explicable by inflation of cancer incidence due to detection of prevalent screen cases, but was associated with a trend of increased cancer detection rates in subsequent screening rounds, probably consequent to quality improvements in mammography screening diagnosis.
Resumo:
This study investigates the relationship between the number of screening mammograms read by radiologists and the screening breast cancer detection rate. Cancer detection rates for incident screens (all women aged >= 40 years) were compared by increasing categories of reader volume using Poisson regression. Data from New South Wales (NSW) for a 2 year period (2000-2001) were obtained from the BreastScreen NSW programme. Cancer detection rates increased with the number of mammograms read in the programme, reaching a plateau of approximately 40 per 10,000 after 1375 mammograms per year. No significant differences in cancer detection were evident above 875 mammograms (compared to below 875 mammograms) per year (RR = 0.79, 95% CI 0.63-0.99). (c) 2005 Elsevier Ltd. All rights reserved.
Resumo:
The firefighters are at increased risk of respiratory disease as a result of exposure to smoke and dust. The aim of this study was to determine the prevalence and risk associated with respiratory symptoms among city firefighters in Sao Paulo, Brazil. Methods A cross-sectional study utilizing the European Community Respiratory Health Survey (ECRHS) questionnaire was administered to firefighters and police officers, in order to evaluate their respiratory symptoms. Results Complete respiraton, data were obtained from 1,235 firefighters and 1,839 police officers. Among the firefighters, there were 55.5% never-smokers, 22.4% current smokers and 18.2% former smokers (P < 0.05). Among the police officers, there were 63.4%, 18.6%, and 9.6% who were never-smokers, current smokers and former smokers (P < 0.05), respectively. Compared to police, firefighters experienced an increase in wheezing [OR = 1.63 (95% CI: 1.43-1.87)], wheezing with breathlessness [OR = 1.34 (95% CI: 1.10-1.64)], wheezing without a cold [OR = 1.60 (95% CI: 1.32-1.95)], waking with tightness in the chest [OR = 1.20 (95% CI: 1.02-1.42)], and rhinitis [OR = 1.12 (95% CI: 1.03-1.22)]. The prevalence of adult-onset asthma in never-smokers was 9.3% and 6.7% for firefighters and police officers [OR = 1.23 (95% CI: 1.01-1.56)]. All independent association was observed between years employed, smoking, history of rhinitis, and work as a firefighter and respiratory, and nasal symptoms. We observed a high prevalence of asthma-like symptoms in firefighters who presented respiratory symptoms beginning immediately after firefighting. Conclusion These results suggest that the prevalence of respiratory symptoms and asthma in firefighters is higher than those in police officers. Work-as a firefighter, rhinitis and vears employed were risk factors for respiratory,symptoms of asthma. Am. J. Ind. Med. 52:261 269, 2009. (C) 2008 Wiley-Liss, Inc.
Resumo:
Background: There is a paucity of information describing the real-time 3-dimensional echocardiography (RT3DE) and dyssynchrony indexes (DIs) of a normal population. We evaluate the RT3DE DIs in a population with normal electrocardiograms and 2- and 3-dimensional echocardiographic analyses. This information is relevant for cardiac resynchronization therapy. Methods: We evaluated 131 healthy volunteers (73 were male, aged 46 +/- 14 years) who were referred for routine echocardiography; who presented normal cardiac structure on electrocardiography, 2-dimensional echocardiography, and RT3DE; and who had no history of cardiac diseases. We analyzed 3-dimensional left ventricular ejection fraction, left ventricle end-diastolic volume, left ventricle end-systolic volume, and left ventricular systolic DI% (6-, 12-, and 16-segment models). RT3DE data were analyzed by quantifying the statistical distribution (mean, median, standard deviation [SD], relative SD, coefficient of skewness, coefficient of kurtosis, Kolmogorov-Smirnov test, D`Agostino-Pearson test, percentiles, and 95% confidence interval). Results: Left ventricular ejection fraction ranged from 50% to 80% (66.1% +/- 7.1%); left ventricle end-diastolic volume ranged from 39.8 to 145 mL (79.1 +/- 24.9 mL); left ventricle end-systolic volume ranged from 12.9 to 66 mL (27 +/- 12.1 mL); 6-segment DI% ranged from 0.20% to 3.80% (1.21% +/- 0.66%), median: 1.06, relative SD: 0.5482, coefficient of skewness: 1.2620 (P < .0001), coefficient of Kurtosis: 1.9956 (P = .0039); percentile 2.5%: 0.2900, percentile 97.5%: 2.8300; 12-segment DI% ranged from 0.22% to 4.01% (1.29% +/- 0.71%), median: 1.14, relative SD: 0.95, coefficient of skewness: 1.1089 (P < .0001), coefficient of Kurtosis: 1.6372 (P = .0100), percentile 2.5%: 0.2850, percentile 97.5%: 3.0700; and 16-segment DI% ranged from 0.29% to 4.88% (1.59 +/- 0.99), median: 1.39, relative SD: 0.56, coefficient of skewness: 1.0792 (P < .0001), coefficient of Kurtosis: 0.9248 (P = .07), percentile 2.5%: 0.3750, percentile 97.5%: 3.750. Conclusion: This study allows for the quantification of RT3DE DIs in normal subjects, providing a comparison for patients with heart failure who may be candidates for cardiac resynchronization therapy. (J Am Soc Echocardiogr 2008; 21: 1229-1235)
Resumo:
Objective: To investigate: 1) the impact of clinical varicocele on reactive oxygen species (ROS) levels in neat and washed semen in a proven fertile population; and 2) the correlation between ROS levels, testicular volume, and varicocele grade in the same population of fertile men. Design: Prospective controlled clinical study. Setting: Andrology laboratory at tertiary-care hospital. Patient(s): One hundred fourteen healthy fertile men (81 normal fertile and 33 fertile with clinical varicocele) and 30 infertile patients (control subjects). Intervention(s): Standard semen analysis and measurement of sperm ROS production. Main Outcome Measure(s): Seminal parameters, seminal ROS levels, seminal leukocyte levels, clinical varicocele, and testis size. Result(s): Thirty-three of the 11.4 (29%) fertile men had clinical varicocele (grade 1, n = 14; grade 2, n = 11; and grade 3, n = 8), and the remaining 81 (71%) had a normal physical examination. Levels of ROS and semen quality did not differ significantly between the fertile men with or without varicocele. No significant differences in ROS levels in neat and washed semen were observed compared with fertile men with grades 2 and 3 varicocele and with fertile men with varicocele grade 1. The ROS levels in neat and washed semen were not significantly correlated with varicocele grade in fertile men. No significant correlations between ROS levels and testis volume were observed between the fertile groups. Conclusion(s): The presence of clinical varicocele in fertile men is not associated with higher seminal ROS levels or abnormal semen parameters. Levels of ROS are not correlated with varicocele grade or testis volume in the same population of fertile men.
Resumo:
Problem We evaluated associations between a length polymorphism in intron 2 of the gene coding for IL-1ra (gene symbol IL1RN) and pregnancy outcome in a population with a high rate of preterm birth. Method of study Subjects were pregnant women in Maceio, Brazil and their newborns. DNA was tested for IL1RN genotypes and alleles by gene amplification using primer pairs that spanned the polymorphic region. Every subject completed a detailed questionnaire. Results The frequency of allele 2 (IL1RN*2) carriage was elevated in mothers with a spontaneous preterm birth (SPTB) in the current pregnancy (P = 0.02) and also with a prior preterm delivery (P = .01). Both SPTB with intact membranes (P = 0.01) and SPTB preceded by pre-term pre-mature rupture of membranes (P = .03) were associated with IL1RN*2 carriage. A previous fetal demise was more than twice as prevalent in mothers positive for two copies of IL1RN*2. Conclusion Maternal carriage of IL1RN*2 increases susceptibility to inflammation-triggered spontaneous pre-term birth.
Resumo:
IL-1 is a key proinflammatory driver of several autoimmune diseases including juvenile inflammatory arthritis, diseases with mutations in the NALP/cryopyrin complex and Crohn's disease, and is genetically or clinically associated with many others. IL-1 is a pleiotropic proinflammatory cytokine; however the mechanisms by which increased IL-1 signaling promotes autoreactive T cell activity are not clear. Here we show that autoimmune-prone NOD and IL-1 receptor antagonist-deficient C57BL/6 mice both produce high levels of IL-1, which drives autoreactive effector cell expansion. IL-1 beta drives proliferation and cytokine production by CD4(+)CD25(+)FoxP3(-) effector/memory T cells, attenuates CD4(+)CD25(+)FoxP3(+) regulatory T cell function, and allows escape of CD4(+)CD25(-) autoreactive effectors from suppression. Thus, inflammation or constitutive overexpression of IL-1 beta in a genetically predisposed host can promote autoreactive effector T cell expansion and function, which attenuates the ability of regulatory T cells to maintain tolerance to self.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
Background: The use of springs in cranial expansion has demonstrated to be effective for craniosynostosis treatment. The spring-exerted expansile action has been observed when springs are placed both in the sagittal and parasagittal regions, mainly in scaphocephaly. In this study, a variation in cephalometric measurements under expansible spring action on the skull base was analyzed. Methods: Thirteen 4-week-old New Zealand white rabbits were divided into 4 groups: group 1, in which only amalgam markers were used (control); group 2, in which amalgam markers were used, and a sagittal suturectomy was performed; group 3, in which amalgam markers were used, and a sagittal suturectomy was performed with placement of expansible springs in the interparietal region; and group 4, in which markers were used, and a linear parasagittal craniectomy was performed with spring placement. All animals were killed at weeks 2, 4, 8, and 12. Radiologic control with cephalometric study was performed. Results: Distraction of amalgam markers in the groups with springs was greater than in those without springs. A proportional change in the angles measured through craniometry was observed in these groups. Conclusions: The experimental rabbit model was shown to be adequate to the analysis proposed by the study. Under the action of springs, the groups with sagittal and parasagittal osteotomy were found to present a similar distraction of amalgam markers. A concomitant change in cephalometric measurements occurred, suggesting a change in the skull base mediated by expansible springs placed both in the sutural and nonsutural sites.
Resumo:
Objective. The objective of this study was to evaluate, using computed tomography, correlations between Hyrax appliance opening and post-SARPE skeletal changes. Study design. Fifteen patients underwent SARPE according to a specific protocol and were followed. Linear and angular measurements of the anterior, intermediate, and posterior portions of the maxilla were evaluated. The correlation between maxillary expansion and appliance opening was investigated. Results. Significant overall expansion was observed. In the anterior and intermediate portions of the maxilla, the increase in maxillary width was greater than that observed in the posterior portion. The degree of appliance opening was significantly greater than that of the skeletal expansion. Also, no linear correlation between appliance opening and regional maxillary expansion was established. Conclusion. The transverse expansion of the maxilla was less than uniform. The lack of linear correlation between appliance opening and skeletal expansion is attributable to multiple factors, including those related to the device, the surgical technique, and the craniofacial deformity itself. (Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2008; 106: 812-819)